Description :
From Genome Similarity Track
Location :
contig_22:478184- 480537
Transcript NameFunction/comments
g5671.t1hypothetical protein

Sequence
2353 bases(100 bases per row)
GTCTGCTGCTTTACAGCGCAGTCGACGACAACGCAGATCGCATTGTCGTGCCGGATGATCATGAGCTGAAGCTCAAGATCACGTACGAGTACCACGATGC
CCCGACATCGGGACATCCTGGCCGTGAGAAGACATATTGCTTCTCACGCGTGACTTCTATTGGAGTCACCAGTAAATGGGTACGCAAGTACGTTCGTGCT
TGCGAGGTATGCCAGCGTGTGAAGCCTGCGCCCAACTCGCAGGCTCCGCTTCAATCACTACCGACTCCGTCGGAGTGCTGGCAGTCCATTTCAATGGACT
TTGTTTTTGGTCTTCCGCAAGACAAGCGGACTGGTATGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTGCATCTTGCTGCAGTACCAGCCGAGGTGACA
GCCAAACAGACGGCATGTCTGTTTGTCGACTGGTGTTTAGACACCATGGTATGCCACTCGACATCGTGTCGGATCGGGATCCGCGCTTTACAGCGCGATT
CTGGCAAGAAGTGTTTACACTTCTTGGGACGCAGTTGTCCATGTCGACTGCGGATCACCCGCAGACCGACGGACAAACAGAGCGTGTCAACCGCGTGCTG
GTTGACACCATGAAGAGCTACGCGCACTCGTTCCATCAATGGAGCGACTGCTTGCCGATGGCGGAGTTCGCCATCAACAACTCGGTGCATGTCTCGACAG
GACACACACCGTTCTACGTGAATGCCATGAGGCACCCACGCGTACCGAGCGTACTCGGTGCGGTAGCTCCTTCCTTAAGTGGGGGAGGATATCCGGTTAA
TTCAAAACAACCGGATAAGCACGCTGATACAAGCAATGTATCAGCTGTGACGACTCGCGCACGTACTGCGCGCAGTCATGGCGACGACAAGACAGTGTCT
ACGACGGGCGTAGACACTTTAAACGACAACGAACATCACGCGCAGGCCGGGCCTGCTGCGAACAAGGAGCACGAACTGAACCAGGGGTTCAGCTCGGATG
CAATGGACTTTGTCCAGCGTCGACAAGCCGTTTGTATAGCAGCTTCTGTCGATCGACAGAAGCTGAATGCCGATAACACCGGCAGGGGAAACACAAATGA
ATTCAAAGTTGGTTCATTAGTTCTGTTAGCTACGCAGAACCTAGCTAAACATGCAGTTTCCGATTTCGGAGCAAGCAAGCTTGCTCCGCGCTTCATTGGG
CCATTCACCGTGTTGGCGAAGCATGGCAACGCGTACACACTGGACATACCGTCCAGCATGCGCTTGCACCCAACGTTTTACGTTGGGCGACTGAAGCCGT
ACGTGCAGCACGAGTCACCTACGTCTGGTGACTCGCCAAAGCGCTCTCGAGCGCGGCGACGCGCTTCGGCGCCAGAGAGCCTCGTCCCGACCTCGACCTT
TACGTTCGAGGTCGTCTGCGCAACCTCCGCGAGCTGAGCCTTCAACAAGCTCAGCTCCTGACGCAGAGCAGCGAACTGCGACGCTTGGAGACGCTCAACA
GCCTCCAAGCGAGACTCAAGGTTTGGTTGACCAAACCCGGGGCGTCTTCCCGCCCCCCCACCCCCGTTGCGAGACGCACGCGGGGCAACTCGCTGGATCG
TCCAGCGAATTGTTGGTCATCGGAACCAGACCCGAGGTCCGGTTCATTTTCGTATTCGTTGGAGAGGATTTCCTCCCCAACACGATACGTGGGAATCACG
GAATGTCCTGATGGAGGACATTCCGGAAATGGTGACGGCGTACGAAGGCCGCCACCGCCACCTCCGCCGAAGGGCGTAAAACTTGGGCGAGCGCTGTAGT
CGCCTACAGCACTCGGATAAGTGCTGCGATTATCCGCAGCACTAGAAGACGCCTGCGCCTGAAAACTGGCGCGCAGGGTCTTGAGGTCGTCAGGTACACA
CATGGACGTGTACCCGTTGACGTCCCGCTCGGTGATGCGTACTGCTCCGGGGTAGCAGTACTCACAAGCAGTGTCATAAGGCACTGCGCAAGGAAGTCCA
ATACCGACTGCACCATGGTGCAGTCGTTCAAGTTTACCACGCTTCGAGAACTTCTCGTAGCGCTCCCGCGCCTGGCTAATCCGGTCGCGATAGCCAGCGG
GGTTCTTGTTGAAGTTTTCAACAAAGGCACTCCAACTTTGACAAAGTGCCTGCCACTCGGGCACTTTGCTTCTGCGAGAAGTCTTCTTGCTCGCAAACCA
TCGGAGCTCATGGAAGAGCCCGATGTAGTAGTCGCGCCTTTGATTCGTTAACGGATCAAAGTGTACTCGCTTCGCGACGTCATCGTCAACGATGGCGTTG
CACGAATACAGCGCGTACAGATTCGGTGGCGCGGTCGCACCGAATCGGCTGCC