Description :
From Genome Similarity Track
Location :
contig_22:478145- 480498
Transcript NameFunction/comments
g5955.t1hypothetical protein
g5956.t1hypothetical protein

Sequence
2353 bases(100 bases per row)
CTGCTTTACAGCGCAGTCGACGACAACGCAGATCGCATTGTCGTGCCGGATGATCATGAGCTGAAGCTCAAGATCACGTACGAGTACCACGATGCCCCGA
CATCGGGACATCCTGGCCGTGAGAAGACATATTGCTTCTCACGCGTGACTTCTATTGGAGTCACCAGTAAATGGGTACGCAAGTACGTTCGTGCTTGCGA
GGTATGCCAGCGTGTGAAGCCTGCGCCCAACTCGCAGGCTCCGCTTCAATCACTACCGACTCCGTCGGAGTGCTGGCAGTCCATTTCAATGGACTTTGTT
TTTGGTCTTCCGCAAGACAAGCGGACTGGTATGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTGCATCTTGCTGCAGTACCAGCCGAGGTGACAGCCAA
ACAGACGGCATGTCTGTTTGTCGACTGGTGTTTAGACACCATGGTATGCCACTCGACATCGTGTCGGATCGGGATCCGCGCTTTACAGCGCGATTCTGGC
AAGAAGTGTTTACACTTCTTGGGACGCAGTTGTCCATGTCGACTGCGGATCACCCGCAGACCGACGGACAAACAGAGCGTGTCAACCGCGTGCTGGTTGA
CACCATGAAGAGCTACGCGCACTCGTTCCATCAATGGAGCGACTGCTTGCCGATGGCGGAGTTCGCCATCAACAACTCGGTGCATGTCTCGACAGGACAC
ACACCGTTCTACGTGAATGCCATGAGGCACCCACGCGTACCGAGCGTACTCGGTGCGGTAGCTCCTTCCTTAAGTGGGGGAGGATATCCGGTTAATTCAA
AACAACCGGATAAGCACGCTGATACAAGCAATGTATCAGCTGTGACGACTCGCGCACGTACTGCGCGCAGTCATGGCGACGACAAGACAGTGTCTACGAC
GGGCGTAGACACTTTAAACGACAACGAACATCACGCGCAGGCCGGGCCTGCTGCGAACAAGGAGCACGAACTGAACCAGGGGTTCAGCTCGGATGCAATG
GACTTTGTCCAGCGTCGACAAGCCGTTTGTATAGCAGCTTCTGTCGATCGACAGAAGCTGAATGCCGATAACACCGGCAGGGGAAACACAAATGAATTCA
AAGTTGGTTCATTAGTTCTGTTAGCTACGCAGAACCTAGCTAAACATGCAGTTTCCGATTTCGGAGCAAGCAAGCTTGCTCCGCGCTTCATTGGGCCATT
CACCGTGTTGGCGAAGCATGGCAACGCGTACACACTGGACATACCGTCCAGCATGCGCTTGCACCCAACGTTTTACGTTGGGCGACTGAAGCCGTACGTG
CAGCACGAGTCACCTACGTCTGGTGACTCGCCAAAGCGCTCTCGAGCGCGGCGACGCGCTTCGGCGCCAGAGAGCCTCGTCCCGACCTCGACCTTTACGT
TCGAGGTCGTCTGCGCAACCTCCGCGAGCTGAGCCTTCAACAAGCTCAGCTCCTGACGCAGAGCAGCGAACTGCGACGCTTGGAGACGCTCAACAGCCTC
CAAGCGAGACTCAAGGTTTGGTTGACCAAACCCGGGGCGTCTTCCCGCCCCCCCACCCCCGTTGCGAGACGCACGCGGGGCAACTCGCTGGATCGTCCAG
CGAATTGTTGGTCATCGGAACCAGACCCGAGGTCCGGTTCATTTTCGTATTCGTTGGAGAGGATTTCCTCCCCAACACGATACGTGGGAATCACGGAATG
TCCTGATGGAGGACATTCCGGAAATGGTGACGGCGTACGAAGGCCGCCACCGCCACCTCCGCCGAAGGGCGTAAAACTTGGGCGAGCGCTGTAGTCGCCT
ACAGCACTCGGATAAGTGCTGCGATTATCCGCAGCACTAGAAGACGCCTGCGCCTGAAAACTGGCGCGCAGGGTCTTGAGGTCGTCAGGTACACACATGG
ACGTGTACCCGTTGACGTCCCGCTCGGTGATGCGTACTGCTCCGGGGTAGCAGTACTCACAAGCAGTGTCATAAGGCACTGCGCAAGGAAGTCCAATACC
GACTGCACCATGGTGCAGTCGTTCAAGTTTACCACGCTTCGAGAACTTCTCGTAGCGCTCCCGCGCCTGGCTAATCCGGTCGCGATAGCCAGCGGGGTTC
TTGTTGAAGTTTTCAACAAAGGCACTCCAACTTTGACAAAGTGCCTGCCACTCGGGCACTTTGCTTCTGCGAGAAGTCTTCTTGCTCGCAAACCATCGGA
GCTCATGGAAGAGCCCGATGTAGTAGTCGCGCCTTTGATTCGTTAACGGATCAAAGTGTACTCGCTTCGCGACGTCATCGTCAACGATGGCGTTGCACGA
ATACAGCGCGTACAGATTCGGTGGCGCGGTCGCACCGAATCGGCTGCCGATCT