Description :
From Genome Similarity Track
Location :
Scaffold_193:47804- 50321
Transcript NameFunction/comments
Phyta_totarag5370hypothetical protein PHYSODRAFT_257067

Sequence
2517 bases(100 bases per row)
ACGTTACGATTCAAATCTGCACGTTAATCAGGTTCAGGTATCACAGTCGGATAGATGACTACTGTGGTGGGTGCAAAGCTTTTGAGAGATGGCTAccttc
cttttcttcttgcgaAGCGAGTCCTCGACTTTGGAAGTCCTTGAGTCCCTCTATCACACGTAATACGTCACGAACATATCAAGCAGGTCCTTGAAGACAG
TTTGTATTTTCGTCAAAAAGCTTGGCGTGGTCGGCTCTCGTCTAAAACCAACGGTAACGGAATCACTGGACCAGAGATACACCGGGTGTTTCTGCTAGGT
GATCACTGGTTGGCTTGGGGTGATCAGGACGAGATCGTTCAAGTCGCTCTCTGCGTTCATGCCACCGAAGATCAACAGTCCCTCTCGTCGGGTCTTCTCA
GCTCCTTCGGATGGCGCCTGAATCGTCACAGTCGTGCCACAGTGTCCAAACCGCTCCGGAATCTCCGACAAGGAGGGCTCCGCcggctgcttctcgtccc
TCGCAACAGCTATTGTGACAGATAGCCAAGACTCCTCATCGTCGGAATAGTGACAGCAGTCACGGCGGATATGGCCTCCATCCCAGCCACCGAAGCTTAT
CAACTCTCCAGCGACAACGCCAGCGGCGAGCGAGCAGCGATTCCATTCGCAGATTGGTACGAGTTGCCACGTCCAACTGCTGAAgttgagcagcgccatg
tCAGTGCAGACTTTCCCGTCAAAGTTGCGCCCCCCAGCGAAGCAGATCGTGTTCTCAGACTGCAGAAGTGCACAATGGAGCTCTCGAGCTTCTGGGATCT
CGCCGCCTGGCCTGAGTTTCTCCCATCGGAGCGTCGTTTTCTCGTATCCTTCATCGTTGACCGGGatgtggagaaggtgaaggtcgCTGGAAGCGCCGTA
TTCAGGCGAGGAGCCACCGTACACTAGCATTCGTTGGGTCTTTGCCGATTCGTCCTCCTCGGGGAGCGCAATCGCAGCGTGTGCGTtccgaggacgagga
gcaTCACCTCCGACCGTTGCCTTCGTCCACAACGAGTTCCGTGTGTCGAAGATGTGAACGTCACTGAAGATTTCACTCTCCGCAGCATTGAGCCCACCGA
AAACGTAGATTTtagtgccagcagcaacagcagaatggccgcttcttggtggcagaCTGCCGCTTGAAGGCTTCACCAACGTCCATCTGCGTGCATCTAC
ACAATGCAAGTCAACGTTTGAGAGCAACTTCTCCTTTATTGCCGCAGTGAACTCACCCAAATCGAAGCGATACACGTCGCCGAAACTCGTGCCTTCTCGG
TTGGCACCCCCGATCAAGTAAATAGCGCTGGTTTCCTCCACCTGAATGGATGGTCCAGCAAAAGCACAACAAGATGAACGAACGTGTCAGCCAGCAGCCG
CAACGATGTGACAAGCCAGCCTGCCAAAAGATACCTGCGTTAAGGTCGCTCCGCCGCGCTTCGCTGGCTTCGTAGCCAACGTGCCGCCATCCAACGCCAC
ACTCTCAATCGAATACTCGCGTGGACGCTGCTCCCCACACAGAGCCTCCTCTTGATTCGTCGacgccatcagcagcagaagtcgaaATGAACACACACGA
CACGATCCAAAAGCGAAGAGCCGCGACGTCTGACCCACAACCGTCTGCAATTTCAAAGTGACTACTGTATCAACCATTAATTACTCcagaaggcagcagc
aagcagctcgcaTTGATCCGTTACTCGTCTCTCCTGTTCATCTCGTCTGCGGTGGGGGAGGCGGCGGGGGCGGCACCCCCATCATccccgctgctgctgg
gggtGGCAGGTAGGCCATCCCCATGGCCAGACTCTGCGGGGGCGGAGGCGGCACCATGCCCATGTCCATCATATTGTACCCCCCTCCTTGACCTCCGAAC
TGCTGAGACGGGGCCCCATTGGCCACCGTGAAAGCGAACATGGTGTGAGGCTGGAGTTTGTTCGGATTGCGTTGCGCCAGCAGCCGCTCAGCTTCCGACC
CGTGACGTTCATTCTGACtgtccttcttgaaggcgaactgcaccaccacctgaCGGTTACACAAGTACTGGCCATGCATACACTCGATGGCCAAGTCGGC
CGCCTCGAACGAGTCGAAACTCACGAACCCGAACCCTCTGGACGCCTTCGTCTCCGGGTCGCGCATCACCTTTGGGGTCTCGATGATGCCCCCGAAGGCC
GAGAACGTGTCatacagcagcttctcgtccacctctGGGTCCAAGTTGCCTAAAAATAGATTCGCGCCCACGTCCAGGTTTTTCTTGTCGTTGGACGCCT
TCTTGACCCTAATCACCTTCCCGTACAGCTGGATCATGTTTAAAACCTTGACCGCGTACTCGGCGCACTCCTCCGTTCGGAACTCCACGAAGCCGTAGTT
CTGGTGGCTGCCCGTCACCTTGTCGCGCGGCATGTGCACGTTGCACACGCTGCCAGcctgcagcatcagctcccacagcagctcctcgctcACGCGGTCG
TCCAGGTTGCCCACATA