Description :
From Genome Similarity Track
Location :
Scaffold_645:4780- 6694
Sequence
1914 bases(100 bases per row)
TCTTGGCTCTCTGTGGACTTCATGAGATTTCTGCGAGGCGTCGTTCTGTGTAGACGACGCGTCCAAGCTGTGGGTTTGCCTGTCAGCCTCCAGTTGCTTC
AGCATCATCGACACAGTATCCACTTCAGTTTTGTTCTCGTTAGCGTGAAGTTTCTGCTGAAGTTGCTCGATATCCTGGGTAAGTTGCCTCTCTTTCTCGC
TCGCAGCTTCAGCTATTTTCCCCAGCAAGCTCTCGTGGTGTTGTCGCTCATTGGTAATTTGGTCGCACAGCTTCATCATAGACTCTTGCAGGCATTCGAT
CGTTTGGGTCCCATCTTCTGCAGATTGCTCAAACTTCGCGATGAGCTTCTTGAGCGAGCCATTCTCCTGGACCAGTTCGGCGATCTGGTTCTTAACGTCG
ATTAGTTCATCTCCGAAATGCTTGCAGCGCTGCAACAATGTTTGATTCTCCACTTTGAGGTCTTCATTTTCTTGTTCTAAGCGAAAAATGCCGTCGCATG
TGGACGTATCTGGTTGTTTTGCCTCGAGTAATGGTGGAGAGCGACCCTCCTCAATGAAAGCTCGGCATTCAGCGTACAACTAAGGAGAGATGAATGTCAG
CACCATAGAAATCTGATTTGTTGCAAGCTTGAGAGAGACACCTTCGACAAACCTCTTTGATATCCGTGAGCTGCGTCTGAACTAAACGTGAGAAAGAAAT
GTCGTTCAGTTAGTCTCTGGAAGAGTATTTGAGAGAAAGTGGAACGAGGGAGTACTCACGGCTGCTAATCTGGGAGCTCATATCCTTCCCTTGTTGCTGC
AGTGACGCCGTTGCTTTCCGCACGTGATCCTGCATTCGAGTCATATCTGAGTGTTTAAGACAAACGTTACATGATAATGTAACGCCTCAAAGGCAACGAA
GCAGACACAGCACCATGTTGTCGTAGACTTCGCGTTCCTTTCGCGAAAAATTCGCAGCAACTTGCTCGAGCTCGCTACCGAGAGCGCCGCCTCCCTGGAG
TCCTCCATGTTGCTTCGAGATGAGCTCTACCAACTGTTGGTTCAATCGATCAATGGTCTTGTCTTTTTCCTCCAACTGCGTTTTTAGGCGTTGATTCTCT
GTCTCCAGCTCGCCCTGTCAAGCAGACAAGCCGATTTTAATCCAACGCCAGGTAACTGCTATCAGTTCTACCAAGCGCTTACTTTCTGCATCTGCGCTTG
CTGCATTTGCTGGTTCGCCCACGTTAGATCATGCTGACACTGCTGCACTTGCTGGCGCGCGTGCTCTCGCTCCAGCCGTGCTTCCTGCTTACACCGCTCG
TGTTTTGCCTCCAGCTGGGCCGTTTCTTTCCTGCTGACATCAGCTTGCTGCTCGTGCGCTTCGAGCGCCGAATAGAGCGCATGCACTATCTCGCGCAGCT
CATTCTGCGCAAGACTGTACTTGAGGACGACGAGCGCGGCGTTGTTGTCGTTGCTGTTGCTCTCATTCTCATGATGGCTGTCGCCAGATCTTGACCTCGA
GATCGGATCGTCGAGAACGGCCCATGGTGGACGAGCAGAAGATGTAGCACTTGCGCTGCTCGTGGTGCTGCTTTCGCGCGCAGCGCATGCCGCATCCACA
CGCGGTTCCGCCATTTCGATAGCTTTGTGAAGTTGAAGTGCGACCCCCGATGACACACACTCCGTGAGGTTTCCGCTTGATTTTTGAATTTGCCAGGAGA
AAACCTCTTTATAATATATCATTAAAGAGGACAAACATATACAAAAAATAAATTAGTATTATGATCACATTACAAAGAGGTAACCAGAATCCTGTGTGCT
CCAGTTGACTGGATGTCGCGAGAAGGTTGCACCAATTCACCTTGAGGATACGGAGTCACCTTCACACGACATTCACGACGTTGCTTTCCCTCAGCTTGAG
ACTGCGATTGACAT