Description :
From Genome Similarity Track
Location :
Scaffold_1521:478- 4403
Sequence
3925 bases(100 bases per row)
TTCTAATCCCGGCGGAATCGTGGGATCAGTTGTGCGAGAGAGTGACATCCCTACTGGAGGCGTGTACTAAATGGAATCTCTCTATCAGTGTGGTAAAGAG
CTATTGGGGGATGCGCAAGGTGGATTACTTAGGCCATCGAGTTTCCAAGGAGGGATTGGAGGCGAATCCTAAAGACCTGTCTTCGTTAGCCGGCTTGTCC
TTCCCACAGTCGTTACGGGCGATGCAATCCTTCTTGGGCAGTTTGAACTACTACAGTCGATTCATCGAGGATTATGCACTGTTTGCTGCAGTACTATATG
AATTGAGAGAGGTAGATTTTGCCGCGATGACCACTTCAGCTGTCCGGATCAAAATCCAACAAGCTCTGGCCCTGGAGATGTCGGATCCACGAAGGGATCC
AAGTAGTACGACGCCAGAAGAGGACCTAAAACAGGAGCTGGATCCACCCCGGGACCAACAGAGAGAGGATCCAGGCTGGATAGAGACGACGGATCAGAAC
ATGGAAAAGGCAGAATCTCGGTGGATCCGAGCTCAACACGCATTCGTGGAACTGAGGAACAGGATTGCGACCACGCCTATCCTCCGTCATTTCGATCCAG
AACGTCAACCTACGGTTATAGTTTATGCCAGCGACTGGGCAGTCTCAGCAGCTCTGGTACAAGAACATGAGGGGATCTGTCATCCAGTCACCTTCGTCAG
CCGGACACTGAAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTCGCGCTCCTGCGCGTGTTGGATCTGAATTACAACCTGCTGGTGGGA
AGATCCATCCGGATCCTGACCCGACACTCTACGCTAGCCTGGCTGTTCAAGTCGGCCGGGTTACAAGGACGTTTGGGACAGTGGGCAGCTCTACTCTCGC
CTTGGACACTGGAGATTGTGAAATGTTCGAAAGGGGAAGACGAGATCCTGGGAGTCTTGGCCACGAGCATTACACCTCGAGCTAAGATGGATGAGGCGCT
GACTAGGATCGCTCCTAAGAAAGAGCCCAAACGCCGGACCCAGATCCCGATCCCGACGGTACAGGTGGATAAGGATCTGTACGTCCTGAGTTTCGATGGA
TCCGCTCGCGTACGACGCGGAGGACATACAGACGCGGAGGGCATACAGCGCAATACTGTGGAGACTGCCCGGATGGGAAGTTGTACGGGCCAGATCCACT
TATGCGGAAGGCCTCACCGTTAACGAAGCAGAGTATAACGGGCTACTGCTGGGTTTGGATCTACTAAAGGGACAAGATCCGAAAAGGCTGGTGATTTGTG
GGGATTCAAATTTGGTGATCAGACAGGTGCGAGGTGAGATTGACTGCAAGGCCCCGGCCCTAACACTGTTACGGCAGAAAGTGATGATCCACCTGCGCGG
TTGGATGAATCACGAGTTGGTGCATGTCAAGCGAGATTGGAATGCTAGTGCGGATAGCTTGGCCAGTGCCGCATATGGAATCAATGCGGCGTTGAAGTGG
AGAGAGAGGCCGAGCATCAGGATCTCGTTACGTTGAACCCGACTAGACGAAGTGGTGGTAGTTGGATCCGGGAAAAGGACAGTCCAGGTGATGGCAGTCA
CGAGGTCCAGAGGAAGGATTGGATCCAGTCCCCAGATCCTCGAGGAAACGTTTGTGAAGAGAGTCCGCATTGGGCGGATCCTCAAAGCACAGGACGAGGA
AGCGTGGATCCTAGGACTAAAGAAGTATCTGATGGGGGATGTACGAGACCTGAGTCGGGAAGATGCCAAATCCTACAGCATTATCGCTACGGATTACGCG
GTGGATCTGAATGACTTGCTCTTCTATTGCCCCCCTACGAAGAGAGTCAACGAGGGTCGGGATGGATTGATGAGACTGGTGATGCCGGAGACCTTACAAC
AGGATGTCCTACACCACTATCACGCTAGCTTGGAAGGCGGACATCAGGGTATTGGTCGGACCTACCAACGGATCCGGGAATGTTTCCACTGGAGGGGACT
ATTCAAGAGCGTACAACGATATGTCGGTGAATGTGTGGATTGTGAGACAGGCAAGGGCAGGCCCACAATCGAAGGGGAGTCACCTGGGAATATCCAAGCG
ACTTACCCTTTTCAAATCATAGCCATGGATCATATCCCCTCGTTGCCCAAGTCGTTCAAAGGAAACACAGAATTGTTGATTTGGGTGGATCTGTTTACCG
GATACGTAATAGCCAAAGCTAGTGCGTCTATAAGTGCGCAAACCATTGCTGAATCGTACGAGGAGTGCGTTTTCCGAAGATTTGGAGCTAGCGAGATGAT
TAGGCATGAATCGGGAGCCAGGCTTTATGTCCGATTTCTTTCGAGCATTCAACCGGATCCTGGGCAGCGACAGCGAGCAACCATGGCATATCGTCCCCAA
GCTAACGGATCGGCCGAGCGCATGGTGCAGACAATCACGAGAGCACTCAAGATGTATGTCCAGGATTTGGATCAGAAGGATTGGGATGAGTACGCAGAGC
GGCTTCCCTTCGCGATGAACACCGCCCAAGACAGGATCCGGGGTGATACACCATTTTACTTGGTACATGGGTGGGATCCCAAATCCACCCTGGAAGCGGC
CATCCCAGTTTGCAGCACCAAGAAGAGGAACCGAGATCCAAGGCGATGGCGATACCAAGTCCAGAAATACTACCGGCAAGCTAGATCCCAGGTGAACGAA
CGACTGCGGAGTGCGATACAGGTCGAGCGAATCGACACTACGAAGATGTCCGTCCACATCAAATCCAAGTGGAATCGCAGGTGTGACATTATTTGGATCG
AGTGAAAGAGGGGTATGCCCGCAAATTAGCCCACCTATGGCACGGACCCTTCCGGGGGTGAGCGAGAGGATGGAAGAACATGCGGTAAAGCTGGAAACGG
TAGGTACCGAATACCGCCTGTTCCCTGTGGTACACGTATCCAAGCTGAAGTTGGTCAAATAATATCCGGATCGGCCGCAGATCCGTCTTTCGGTGGATGA
ATCCGACCGGGTGGATTTCGACGAAGTCCTCCTACCGGAAGATAGTTGGAATGTGGATCTCGAAGACGACGAGTTCGAAGTCGAGAAGATCACCGACATG
AGGTCAGGGAAGCGAACTAGATACGGACGGATTTACCGTAAATTTCTGGTGTATTGGCGTGGATTTGACGAACCCAGTTGGGTAGACGAGGCAGATCTGA
ACTGTGAAGCATTACTCTATGATTTCTTGAGGGATCGTACGAATCGTAACAGATTCGGCGTGATGCAGTCTCATGAAGAAGAGTAGAAAAGGGATCCATT
GATGTGAGTTGGTCATATCGATGGGAGAATGAAGAAGGGCCCACAGGAAGGGTGTGGGCCAGGAGGAGGAGGATCGCTGATGTGAGTTGGTCACATCGGA
AAGAAAGAGAAGACGAATCTACAGGAAAAGAGTGGATTACGAGGAAGAAGAGAATGTTTATGCATAAAGAGTGACGTTTACGTGCGAAGAGTCCTGCTTG
ATCTCAAGCGCGAGCTTTCAAGCGCCTGAGCTATACTGACTCAATTGAAACTGGGTCGTTGGCGCTAGGTCCTGATGAAATCCAAGCGTGGACCCAACCG
GATCCGGAATCCAGCCCAGATCCAGGTGTACACTGAAAGGGTGGATCTAGCCCAGATCCAGGTGTACGCTGAAAGGGTGGATCCAGCCCAGATCCAGGCG
TACACTGAAAGGGTGGATCCAGCCCAGATCCAGGTGTACGCTGAAAGGGTGGATCTAGCCCAGATCCAGGTGTACACTGAAAGGGCGGATTCAGGCCCAG
ATCCAGCTGTACACTGAAAGGCCCGGACTAGATTTCTCAACCAACGAGGGAAGGTTATAGACATATTCAAGTAAGAGAGTGTGGATTATGATAGCTTATG
CAAAGGGCTAACTCGACCCAGTTTC