Description :
From Genome Similarity Track
Location :
Scaffold_1432:478- 3376
Transcript NameFunction/comments
Phyta_totarag12965cytochrome P450, putative
Phyta_totarag12966hypothetical protein PHYSODRAFT_499752

Sequence
2898 bases(100 bases per row)
GGTGCAAGATGTGGACCATCGTGTACTTCGAAGCTTCCGTGAAGGAGGTTGCGTTTGCTTCCATCGGTTCCTCTTGAGCCGAAGTACGCTGCCCAAGACA
CCACGCTCTCTGACGGAACCTTCATCATCAGTGTTTCGACTGTCGGTCTGAGCACTTGCGGAAAGGCACGGATGCCGAGcaagtgtgtgtgtgtgacaCA
CATCATTCAATGCTGGACCTCGCACGTGTCTGGAATGAACTTagcgatgctggagatgaagttGGTCGTACGAAGTAGGTTTCACGTCGAAGTGGTGAAC
CCAGAGGACGTGACGAACGATATATCCATGAAAGGCGCCCTCAGCGTGGAGGTTTCACGGGTGCACTGGTCTGCACATGACAGGCACCACTTGGCATCAA
ACATGTAAACACGGTCCGTGTTACACGGATACACGGATGGCGTGGCCAATCCGTTGAGAAAACTTTAGACATCATGATAGTTTTCCGGCGATGTTACCTT
CGGGTCGTACGTAACAACGAAAGTTTATGTCAGTATGACGCCAATACAAATCCATGGAGCGACGACAACCATGGGTTGCATCCGTTTCTGGCACTCCTTC
ACCATTTTAACGTACGGTATTGTCCAGCTACAGTACCATCCCACAAAGCTATCCCGCCGTCCCCGTTGGATCTCTCCATTCCCGGATTCTCCGCCCAGAT
CGCTATCGATCAAGATGCTGACGATCGATCGTATGACCGACAGACTCTCGTCCAgcgttgcagtcgctgcattGAGTGGACTCGTTGTGCTTCCGCTGGC
GTGGCAACTGCTGGCAGCTGCCAAGAAGTCTCAGCATGGAACTCGCAAGGTGGTGCGTCCGACAACGACCAAACCTTTGATCGGCAACACGTTAGACGTC
ATTACCAACCTCCCCGTTCGCCACGACTGGATTGCCAGTTTGTGTGAAGAAGCAAAGGGCGAACCTGTACTGCTCCAGTCTTTAGGAACGCCGGACATGA
CTCTACTGTCGACTCCTGAAGCTTTCGAGGACGTGTTCAAAAACCAGTTTGACAACTTCCCCAAAGGCCCAAAGAAGGCCGAGTATCTGCGTGAACTACT
TGGCGAAGGCATCTTCGCAGTGGACCACGAGAAATGGTATCGCCAACGCAAAGTAGCCAGCAACTTGTTCACCATGCGAGCTCTGAGAGATTCCATGACG
AGTACGATTCAACGTCATTTGGTCGTCTTGGAACGCATCTTCCGTCGGGCAGCGGAGACCAATGACTCGGTGGACATGTTTCGACTGCTTAATCGGTTCA
CCATGGAGGCGTTCACTGAGATCGGCTTCGGGGTGGAGATGAACTGTCTGGATTCCGATAAGGAACATCCGTTTCAGACTGCATTCGACCGCAGTCAGCA
GTCTTTGGTGCTGCGCGTTGTCAGACCGAGTTGGTTCTGGAAAGCTCAGCGCTTGCTGGGTGTCGGGGCGGAGGGTCAACTGCAACAGGACATGAACGTG
ATCAACTCCACCATCTTCGATATCGTGACCAAGACACTCGAACACCGTGCAAAGGGGACGCAAGACGATGATAAGGCAGGGAATGATATCATTTCGCTGT
TCCTGAACGACCTGAACAAATCGGGCGACGCGGACGAAAGCTGCTTTGACCCCACGTACCTGCGAGATGTTGTCGTCAACTTCATCATCGCTGGCCGCGA
CACCACAGCACAAGCTTTGAGTTGGTTCTTCTATTGTCTCAGTCAGAACTTGGAAGTGGAGACCAAGATCTGCGAGGAGATCTCCGCAAAGTtgcccaag
ctgctcgacggACAATGCAGCCCATCAATGGACGAGGTGAGTGAGCTCACTTACGTGGAGGCTGCGCTGAGGGAGACACTGCGCTTGTATCCGTCTGTCC
CCATCGTCAGCAAGGAAGCAGTTCATGACACTGTGCTATCTGATGGCACATTTATTGCTGCGGGATCGTTGGCTGGCTTGCCAATGTACGCACTAGGGCG
AATGCCTCATGTGTGGGGtcctgacgctgctgagttCAAACCAGAACGATGGATCGACTCGCAAACGGGCAAACTCATCTCGGTCTCAGCCTACCAATTC
GTGGCATTCAACGCAGGCCCGCGTCTGTGCCTTGGCAAAAATCTCGCCATGCTcgagatgaagctgatcgTGGCGTCGTTGCTTAGCAAGTATCATGTCG
AGCTCGAGAGCCCCGATAATGTGACGTACGCCATGTCGTTCACTCTGCCCGTGAAGGGACAGCTCAACGCCAAGATTTCTGCTGCTTAGGCGCTGCTGTA
GTTGATACACTCTCTACTCGATCACTCGTAAAAGCAAAGTATTCACGTCACGTTACGGTCAATTATTCCTGTGAGGTTGGAAATTCAAAGGAATGCGACT
CAGGTTACTAGCACACACCATCGATGTGTGGTGGTTTTAGGCATGTGCAGGCCAAGGCTGCGAAACCTTCACGTTCAGGTTGCCTTTCACGGGCAGAGTC
AGCGATAGATCGTACGTCACGTCCTCCGGGttcaccacttcaacgtggaaTTTGGTCAACAGTCCTGCGACGACTagcttcatctccagcatgGCTAAGT
TCATTCCAAGACACATGCGAGGACCGGCGTTGAACGACGCGAACTTGTAAGCAGAGACGGTGAGGAGTTTTCCGGTGGTGGGGTCAATCCATCGCTCCGG
TTTGAACTCTTCGGCGTCAGGCCCCCACACTTGCGGCATTCGTGCCATTGCGTAGATCGCTAGGCCTATAGCTGTACCAGCAGGGACAAAAGTTCCGTCA
GAGAGAGTCGTGTCTTCCACGGTTTGCTTCGGCTCGACAGGAACCGATGGATGGAGACGCAGCGTTTCCTTCAGCGCAGCCTCAAGGTACACGAGCTG