Description :
From Genome Similarity Track
Location :
Scaffold_1293:478- 3357
Sequence
2879 bases(100 bases per row)
TCTGTCTTGGACGAGAACGTCCTGGAAGACATGAACAAGCAGCGTCAGGCGCGCTTGGGTTCTGAGATTCTCAAGAACCCCAAGGATCCGGTGTATCCTT
TGGTGACGGAGTATGCGGACGTGGTGAACAAACACCCACCGACCCAACTCTCACCGGATCGAGGCGTACGGCACGAGATTGATCTCGTGCCCGGCACAAA
GTATTGTGTCACGAGGCAATGGCCTCTCTTGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGTGGGAATCG
AAATCCCCGCACTCGACGCCGACTTTCTGCGCTCGGAAGCCGTACGGAAGTGGTGTCTGGATCACGCTTATAACAAGCTGAACAACGCGACGATGCCGGC
CCAAACACTAATCCCACGAAAGGATGTGTTGTTGAACAACATGGCCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGGATACTACCCAATCCTG
ATGCGAGAGAGCGACATCCCGCTCACCGCGGTAAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGCGA
CGCTCAATCGCCTGGTGACGCAATTGCTCCGCTCTTTGCGTACCTTCGTACAGACGTACTTCGACGACGTATTCGTCCATAGCCGTGCCGAGGGAGGCAG
GACGGCCATGGAGGTGCATCTAGGTCACCTCCGTCGAGTGTTGGACGTAATGCGAGCGAACAAGCTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCA
CCAGAGATTAAAGTTCTCGGTTGCTTCGTAAGCAACGTGGGCGTTCAGGCTAACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCGACGCCCCGATCCC
AGAAGGAGCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTCACAAGTACAGCGCAGGGTACGCGGGCTTCGCTAAGCCCTTGTCGAGTCTCCTTCAGAA
GGACGTCGACTGGCGCTGGGAGCAAGAGCACCAGGATGCATATGACAGCATCAAGGCCAGTCTCCAAGAGGCCCCTGTCTTGGCCTTGCCGGACGAGACG
AAGCCGTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCATTGGATGTGCATTGCTGCAGGCCGACACGGCTGGACACGAACGAGTCATCTCGTTCCAGT
CCAGGCAGCTCAAAGCCGCCGAGCGGAACTACCCTGACCATGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTCCGTGTTCACCTTCTGAG
CTCTAGGGCCTTTGTGATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCAACGGATGGCGAGGTGGCTGTCCTTCTTC
GCGGAATATAACTTCCGCGTCGAGTACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTAGGCGTCCCGACTATGAGTTGGCCCACATCACGC
GGGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTTAAGGCCGGAACGAGCGCGAA
GTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGAGGGCCTCCTCTATTATCGGGTGGAGCCCACTGATCCTCCACGG
GTGGTTGTACCCAACGACGAGGATCTGAAGTTCGACATCCTCGCGGAGGCGCATGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGT
CGGTCTCTCAGTCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGGTACGTCAAGACATGTGAAACATGTCAGCGGGTTAAACCCGCAGGGCACTC
TTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGATTGTTGGAAGTCGATGAGCCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCAACACC
GGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTTCATCTTGCTCCAGTTCCCGTCACTATGACGGGCGAACAAACCGCAAGGTTGTTCGTCGATG
GCGTGTTCCGCTATCACGGTCTCCCGGAGACGATTGTCTCGGACCGAGACCCGCGGTTCACTGCCGCGTTTTGGAAAACGCTGTTCCCTTTACTGGGAAC
TCGTCTGCAGATGTCCACTGCGGACCATCCGCAGACCGACGGCCAAACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCACAGTGTGTGCGCGGCA
GCACCACGTACGTGGTCGACGCAGCTTCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGTTCACGCCGTTCTACTTGAACGGCT
TCCGCCACCCCAGAGTGCCTCTCACTCTTCGAGGAAACACTGACTCCTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGA
TGTGAGGCCAGTTTCGCTGCGGAAACAGGTGGAATCCTTTATGGATACCAAGCTGAACATTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAAGAT
AAACAAAAGGAGTACTCGGACAAACAAGGCAGAGGAAACTTAAGTATATTTGAGATTGGTGACTTAGTGTTACTAGACACGAGGAACCTACCTCTAGACA
CTGTTAGCTCTGTCGGCAGCAACAAGCTGAAGCACCGCTTCATCGGACCTTTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTTCCAAA
GTCAATGACGACGCACCCGACGTTCTATGTCGGACGTCTTAAGCGGTACTTTGACCCGCAGGGGGTTGCTGACTCGCAG