Description :
From Genome Similarity Track
Location :
Scaffold_19:47794- 49562
Transcript NameFunction/comments
Hyaar_Emoy2803274RNA binding protein, putative

Sequence
1768 bases(100 bases per row)
GGCGCCAAAGAGTTCATGTCATGATAAACACGTGCACTTGCCAGCATCCCACTCGGTCACCTGATGACTATTACAGCTGTGCATGGAAACAACCAAGGTG
CGGATCTCATAACACTATTTCAATTTTTCAAGAGTCTGAAAGGCAACAAAATGTCGACTTGAAACGATCTCAACTCAGGATCTATTTGGAACACTTGTAA
TTTCTTTGCAGCTAAGTTTTTACATTATTCTTCTAGGTTGTGATGCTATCGCCGCTAGTGTTGAAGCTCCTGACAGGTCACACCTTGGTAAAGAGCGGCC
GCCAGGTTGCAGCTTCCTGGCCTCCTTTGGCGCTACGATCAGCAGGTTACTACCGCAGAAAATGATACATGTCGTTTACAACATTACCAGGGCAAACTCT
GCCTACCAGAAGTAATCACGATAGGGCGTGTGGACGCCGGCTTTTTCCTCGTATTTCCGTTGATTGCTGTCTGTCAGGAGCGACCAACGCCTATTAGCAG
CATGTTTGTGTGGCCGCTCGATTCGATACTCAGACGAGAGCAAGAGGTCCTTGCGCCACGGTGCTACCAAAGCCACTTACTGTGCTATTGTACTATATTG
AAATGTATCGACAGGGGTGTAACCTCCTTTAAAGCATTCGGCGACTGGCGATCTGATCTTCTAGTTGTTCGGAATAATGACCTACACAACGATCGTTCAA
TGATGCAACAAATTGTGATAGGAGAGCAATATGATTATGCACGTAGTCAAAGAAAATGGCTGAGTCCGAAACCGATGGCAGATAGTACTAGAATATATAA
GACAGAAAACTAAGCTTCTAATTTGTAAGAGTTTGTGCAATTTGAACCCTTATCCCCCGTCGAAGGGTTGCAGGCCTCTGATTGGTGAAGACCGGTTCGA
GGTAGATGGTGTTTACAAGACGGTGTGTATACTGTCACGCCATTAATGATCGTTATGTTCATGCTGGTGCGAAGAAATGAGTGGCCTCTGTTTTCTGGGT
CGGTTGGTGACAGATGCTTATCAGTTGACCCCATCGGGAGATCCAGAAACTCATCGAAATCGTCCAGTTACCGACCACCACTATTCATTTCAAGCTCAAG
CTTGAACCTCAACGTCAAGTCGAGGCTTGTTGCAGAAACGATGCTAGGCAACGAAACACCTTGGGGCCATACAGGTTGCATTTCTGGGATGTACTTGAAA
GAGTCACATGTAACTAGCTTATTCCGCACTTGCACAACTCCTATACCCGTAGGTCCTCAGTCGCACCATCGAAAGTAACTTACTCTCTCTTGTCCAGGCG
CACCTCGATCAGCCGGCCTTCTATTTCAAACCCGTTGAAGCGCTCTGCAGTTCATAATTAGGATCAAGCTTTAGCACCAAGCAATCATGACCATAGAATA
TATAAGGCACTTACCAATCGCTTGCCATGCATCCGCCGCATTCGTGTATCGAATGATACCAAAGCCACGCGAGCGACCGTCCGGGTGCTCGGCGATATCG
GCACGCTCCACCACACCCGCAGTTGCAAACAGATCCTTGAGCTGCTGCCAGTTGGTGTCCCACGGAAGCTACACATAGCGTAAAGTACCGTCGATTAGAA
TCGCCAAGTCTCTTGCAAAGCGACGCACACTTACGTTTCCAACGTAAAGCTGACGACCCTCGCTGCCACCGCCGCCACCACCGTTGGCACCATCGCCACC
ACGTGGAGGTGCAGCACGCCTGGCAAACTTGGAGATGCTACCACCCTCGGATTCTCTGTCCTCGCGGA