Description :
From Genome Similarity Track
Location :
Scaffold_329:4779- 6381
Transcript NameFunction/comments
g9104.t1hypothetical protein

Sequence
1602 bases(100 bases per row)
AACGCTGTGGAAGCAGCAGCCGATCTATCGGAGCCGACGACGTTCCAAGAGGCGTGAACGGTCCGGATCAGGTGCACTGGCGCAAGGCGATCCGCGCGGA
GCTCAAGTCGATGCGACTGCGTGGTGTGTTTCGAGCTGCCAAGTTGCCCAGCGGCCAGCGCGCCATCGGCACCAAGTGGGTGTTCAAGATCAAGCGCAAA
GCGGACGGCTCGATCGAGAAGTACAAGGCGCGCCTCGTGGCCAAGGGCTTCAAGCAGAAGTACGGCATCGACTACACGGAGACGTTCTCGCCCGTGGTCA
AGTACGTGACGCTGCGCATGATCATCGCGATCGCCAAGTACTTCGGCTGGCCGCTCGACCAACTCGACGTCGTGACAGCGTTCCTGTACGGGGTCATGAA
GGAGGTGGTGTTCTGCGTGGTTCCCGAAGGCGTCGAACTGGATGGTGGCTTCGACTGCTGACTGCCTGGAACTGGTGAAGGCCATCTACGGTCTCAAGCA
AGCTTCGCGCGTGTGGAACGAGACGTTCGACGAGTTCATGTGCTCTATCGGCTTCCAAGTGTCGGCCTTCGATCCGTGCCTCTACATCAAGGTGGTGGAC
GGTCAGTGCGTGCTCGTGCTGGTGTACGTGGACGACGTGCTGATTACCGGGAGTTCGCCTGAGCTGATCTCGCGCACGAAGACGGACCTGAAGACGCGTT
TCGAGATGACCGACAGCGGCAAGTGCGCGTTTGTTCTTGGGATCGAGCTGGTGGACGGCCCGGACGGCAGCGTGACCATGTGCCAGCGTCGCTACGTGGA
CGACATCCTGAAACGCTTCGCCATGGACGAGTGCAAGGCTGTGGTGAGTCCGGTGGACATGAGCACTCGACTGGTTCCAAGCGACGCGGCGACCAAGGTG
AACGCTCCGTTTCGCGAAGCTGTTGGTGCGCTGATGCATCTGATGACCGCCACGCGCCCGGACATCGCGTACGCCGTTGGCTATGTGTCGCGTTTCATGG
AGAACCCCCAAGAGGAACACTGGGTTGCGGTCAAGCGCATCTTTCGCTACCTGCAAGGCACCAAGACGCATGGCATCTGCTTCAAGCCGGGCGACAAGAT
CGACTTTCGTGGCTACTCGGACGCGGACTGGGCCGGCGACCTCGCGGACCGCAAGTCCACTTCAGGCTACGCGTTCATGCTCATGAGTGCGCCTGTGAGC
TGGGGAAGCAAGAAGCAGTCAAGTGTGTCGCTGTCCACGAGCGAAGCGGAGTACATCGCGCTCAGTCTGGCTATCCAAGAAGGCAAGTGGATCCATCGCC
TGCTGTGCGAGATTCTGGCGGCTGCCAACGACACGGGACCCGAGCTCATGATCCGCGAAGACAACCAGTCGTGCATCAAGATGACCAAGAACCCGGTGAA
CCACGGCCGCGCCAAGCACATCGACATCAAGTACCACCACATCCGCGACGAAGTGAAACGCGGTGAAGTGAAGCTCGAGTATTGCGAGACTTCTGTGATG
CTGGCGGACATCATGACGAAGGCGCTTGCGGGACCACGCCACACGGAACTGACGGCGGCTCTCGGCATTCATGGGACTTCGCATTGAGGGGGCGTATTGA
GG