Description :
From Genome Similarity Track
Location :
Scaffold_16:47788- 48881
Transcript NameFunction/comments
Sapdi_VS20SDRG_05868hypothetical protein

Sequence
1093 bases(100 bases per row)
ACGCCGGCGACACCGGCCGACGGCACACGCAAGCCAGCGGTGGTTGCCGCCGACGGGCCGTGTAAAAAGTGCCTTGCGAGCAAGGACATGCCGTCGATGC
ACTACGCGGCGTACGCCGGGCACCTCAGCTGCCTTCAGACGCTCCTCGCCACGGGGATCCCGCCGCCCATGGACAAGCACAAGCGGACACCACTCTTCTA
TGCGTGCGCTGCCAACCAAGCAAGCTGCTGCGCCGAGCTATTGGCCCAGCGCCCCGAGTGGATCGATGTCCCAGACGCGCAGCTCGACTCGCCCGTGCAC
GTGTGCTGCTTCTTTGGCTGGGACGCCTGCCTCGAGCAGCTCTTGGATGCTGGTGCCAACCCGCACGTGCGCAACGCCAAGGGCTTTCGCCCGTCGCACA
TCACAAAGACGCCGGCCTGCCTCTCGATTCTCGTCGGCCATGGGGACGATTTGCTCCAAGGTGACAAGCTCGGTCGAACCCCCCTTTTTGTCGCCTGCAC
ACGCGACCGCGTCGACTGTGTTGAGTTTCTTTGCTCGTGGGATTACCAAGTGCATTCGTGGATGCTCGAGCAGGAAGACGACCGCAGCGACAGACCACTG
CACGCCGCCGCCTGCAACGGCAGCCTCGGAAGTCTCCAGGTGCAGCATCGCTAACCTTGTGCGATGTGTCAACAAAAGAAATGAATGCAGGTGCTCCTGA
AATATGGCGCCGACGTGTACGCGAAAAACGTCAAGGGACTCACGGCACTCGACTTGGCCGTCACCAACCAGCACGAAGTACTACTTCCCTTTTTCGTTTG
GACAATTCGACAATCGGTATCTTGCAATTGTAGGACTGCGCGGCACTTTTGCGCCAAAACATCAAGGACACGGTACACATCGTCTATATAGGTCTGATTC
TCTGGACGGTGGCATGAAGGAGAATGCCGCGACTTGGTTTGCGCCGTCACAGTCGCGCCACAACGTCGGGCCCGCGCCGACGACCGAGTGGAGCGAGTGC
ATGGACACGGACAGCGGCCACCTTTTCTACTACAACAACAGCACGGGCAAGTGCCAGTGGGAGCTTCCAGCGGGCTTTGTGGGGCGGCAGTCT