Description :
From Genome Similarity Track
Location :
Scaffold_759:4778- 9446
Sequence
4668 bases(100 bases per row)
AGTAGGGGCGGGGCGCCCTACTGGGGAAGAACTAAGTCTTCGTGATGGGTGCGCGGGTGGCGCGCACCACGGGGACTTAGCCCCTGAGAGTCTTTGCACT
CTCGAATCGGCGAAGAGCAGCGGTGGGTTGCTTGTAGTACACGGATGTGTACGGGGATACGATCATCCCTTTAGAATCTTGATCGATTCTGGGGCGTCGA
AGAATTTTGCACGCCGCCAGACGGTTGCTCGCAACAGCAACAAGCTGTCCGATGCTTTGAGAGAAAGCAAGGGCAACGGGACGGTGTCAGTGCGACTGGC
CGACGGGAAGGTCGTCACTGTCCCCAACGTCCAAGTGGATCTGGCCGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCATTATGATA
TGATCCTGGGCATGCCCTGGCTTGAGAAGCACGAGGCCTGGATCAACTGGCGACGCAAGGCAATCGGTGCTCGCCGCCCTGCAAAGTCCGACAGAGCATT
GGTGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGCAAGGGCTGCCAGGGTACCAAAGCATCCAGCAGATGCTTGGGAGTCGTCGACGTATAT
GACGACTCCGAGGATGTTTTTATGGTGGCAGCGCCAGAAGTGGCGCTGGCCAAGTGGGTAACTTAGGTCCACAGGCGGTTAACATAGTTCCGCAGACAGC
TGCAGCTGTCACGAACACTGAGAACAGCGTGTTCAGAGTGGGTAACAAAGTTCCACTCACGGTCGCCCAGACCTTAACTGAAGAGGAAGACGTCGGATAC
GCTTCCTGTGTGGGTAACACAGTACCACGCGCGGTCGCCCGGACCTTAACTGAAGAGGAAGCGTTGAACACGCTTCCTGTGTGGATAACACGCGGTCGCC
CAGACCTTAACTGAAGAAGAAGGCGTTGAACACGCTTCCTGTGGGGGTACCACAGTACCACACGAGGCCACGAGTACCTCGGATGTCGGTAGCAACGACA
TCTCTAGACGTAGGCAGCAAAAGCTCCATGTCACGGGTCGCCGTCGTCAACGACGCCGCCGCCGCCTCAAGTCGGATCCGAACTTCGTTCCGATCGACGT
CGCTTCAAGCGACTCGAAGTCCAGGGCCCGGGCTCCTCCGACACGGCCGGTGGAAGAGTGTTATCACATCTTCGATAGCGAGACGGGTTTACCCGTCAAG
GCATCTGGTGTCCACTTGGAACCGTTGCCAGAGGTTGCAGAGATACTGAACCTCGAGGAAATGACGGCTGAGTCTTTCCTGGCCAACCTCAAGGCTGGAG
AGATCGCTGAGATGGTACTCATGAGACCTGAGACCACTCAGGAGGAGCTGAACTCCTCCTCTGTCTTGGACGAGAACGTCCTGGAAGACATGAACAAGCA
GCGTCAGGCGCGCTTGGGTTCTGAGATTCTCAAGAACCCCAAGGATCCCGGTGTATCCTTTGGTGACGGAGTATGCGGACGTGGTGAATAAACACCCACC
GACCCAGCTCCCACCGGATCGAGGCGTACGGCACGAGATTGATCTCGTGCCCGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCGCGCGAACAG
TGCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAATCCCCGCACTCGACGCCGACTTTCTGCGTTCGTAAGC
CGAACGGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGAACAACGCAACGGTGCCGGCCCAAACACCGATCCCACGAAAGGATGTGTTGTTGAACAA
CATGGCCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGGATACTACCAAATCCTGATGCGAGAGAGTGACATCCCGCTCACCGCGGTAAGCACT
CCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGCGACGTTCAATCGCCTGGTGACGCAATTGTTCCGCCCTTTGC
GTACCTTCGTACAGACGTACTTCGACGACATTTTCGTCCATAGCCGTGCCGAGGGAGGCAAGACGGCCATGGAGGTGCATCTAGGACACCTCCGTCGAGT
GTTGGACGTGATGCGAGCGAACAAGCTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATCAAAGTTCTCGGTTGCTTCGTAAGCAACGTG
GGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCGACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTACC
TTCACAAGTACAGCGCTGGGTACGCGGGCTTCGCTAAGCCCTTGTCAAGCCTCCTTCAGAAGGACGTCGACTGGCGCTGGGAGCAAGAGCACCAGGATGC
TTTTGACAGCATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGGCCCTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGATTACGCC
ATCGGGTGTGCATTGCTGCAGGACGACACGGCTGGACAGGAACGAGTCATCTCGTTCCAGTCCCGGCAGCTCAAAGCCGCCGAGCGGAACTACCCTGTCC
ATGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTCCGTGTTCACCTTCTGGGCTCTAGGCCCTTTGTGATCTACACAGACCACGCGTCCTT
GAGGACGGCGACTAACTCGCCTCACCTCTCCCAAAGGATGGCGAGGTGGCTGTCCTTCTTCGCGGAATACAACTTCCGCGTCGAATACAAGCCGGGCAAG
CTCAACGTGCTTGCGGACGCCCTCTCTAGGCGTCCCGACTATGAGTTGGCCCACATCACGCGGGTGACAACGGATCTATATGATCGGATACGCATGGCGT
ATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTTAAGGCCGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCA
CCGATATGAGTTGAAGGAGGACCTCCTCTATTATCGGGTGGAGCCCACTGATTCTCCACGGGTGGTCGTACCCAACGACGAGGATCTGAAGCTCGACATC
CTCGCGGAGGCACATGACGCGCCCTCGCACGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTAAGGCCTTCTGGTGGACCCACATGTATAAGT
GGGTCGCCCGGTACGTCAAGACATGTGAAACATGTCAGCGGGTCAAACCCGCAGGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGATTG
TTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTA
CATCTTGCTCCAGTTCCCGTCACTGTTACGGGCGAACAAACCGCAAGGTTGTTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCCAGAGACGATTGTCT
CGGATCGAGACCCGCGGTTCACTGCTGCGTTTTGATAAAAGGCTGTTCCCTTTACTGGGAACTCGTCTGCAGATGTCCACTGCGGATCATCCGCAGACAG
ACGGCCAAACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTACGCGGCAGCACCACGTACGTGGTTGACGCAGCTTCCAGTTGTTGA
GTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGTTCACGCCGTTCTACTTAAACGGCTTCTGCCACCCCAGAGTGCCTCTCACTCTTCGAGGAGAC
ACTGACTCTTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGACCAGTTTCGCTGCGGAAACAGGTGGAATCCT
TTATGGATACGAAGCTGAACATTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAAGATAAACAAAAGGAGTACTCAGACAAACAAGGAAGAGGAAA
CTTAAGTATATTTGAGGTTGGGGACTTAGTGTTGCTAGACACGAGGAACCTACCTCTAGACACTGTTAGCTCTGTCGGCAGCAACAAGCTGAAGCACCGC
TTCATCGGACCTTTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTTCCAAAGTCAATGACGACGCACCCGACGCTCTATGTCGGACGTC
TTAAGCGGTACTTTGACCCGCAGGGGGTTGCTGACTCGCAGACCCCCCTTGACCCAGCTCCTCGAAGCGAGGGCCGGTCACAGTCGTCGACGAGGGCGTC
GGAGCAGGCACCCAAGCCTCGGTCGGGACGGCAAGGCTGCGGTCAAGACCGTACGCCGGAGGGGCTCCATACGAACGGACCCCGGCGCCATACGCCGAGT
ACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCCGCAGGCGGCTCCGGACGTAGCAACAAAGCCTCGATCCGTCGGATCATGCG
AAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGGTCCACCCGCAGGTGCAGGCTCGCGACCTCTCGCTCCACCAGGTCCAGGCGACCCGCAAGACGA
GCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATTACCGCCAGTCCCAAGGCCAAGTGCAATCTC