Description :
From Genome Similarity Track
Location :
scaffold_6:4777- 25530
Transcript NameFunction/comments
g378.t1 phosphatidylinositol 3 and 4-kinase-like protein
g379.t1hypothetical protein
g380.t1 uroporphyrinogen decarboxylase, putative
g381.t1hypothetical protein

Sequence
20753 bases(100 bases per row)
TTGTGGCGGTCTCCGATACCCAGAACGTACGTAGCCACGCAGTACCCAGCGCAAGAACGTACAAAGTTCTCAGTCTTCTCCAGGTCACGAACAGATGGTG
ATTTCTTGCGACGTCGAGGAGATATCGGGAAGCAGGACGAGACTGATGGCGCACCCTCATCTGTCGCTGGACTACTAGGAGCTGAACCAGCAGTTGGCGA
TACTGAGTCAAGAGCAGCATCAATTGAAGGGGATCTACCTTTCGGAGAAGTCGGTTGTTTGAACAACCAATCCGAGAGAACTCCGTCCTTGACAAGAGCG
TCCTTCGCTGCATTGAGCTTTCGTCCCAATTTCGTTAGCGACTTGGCGTGACGCGCATAGATGATGCTTGCCAACGTCTCCGAGTCGCCAATGACTTCGA
TCATGCCGATCTCATCGCCAGTGGAGATGCAAGCGTACGGCAGTAGACAGAGTTTCAGGTTCGCCTCTCTCCACAGATCGTCCATGACGCGCAGTATTTG
AAGCACCAGTTGATCCTGGCGAAGATCATCACCAGCTTTGAAAATCACGTAAGGCCGTCCATGCTGCGTTTTGGCACTTTTAAACTGCAAGAAGAGCGGG
CGCTTCTTCGATTCCATCACTCGACAGCTCTCCGGGATCACGTGGGTGCAGTACGATCGTGGTTGCAATGGAAGCTGGAACGTATCAGGGAGAACAAGTC
CACGTAGAGCTTCGTGGAGCTTTTCCTTCCGAGCTGTGGACGAACTCTCACCTTTCACAATGGCAGCCACCTCCTCGAGCTTCTTCATCACGTAGACCGA
CTGACGGATTTCCAGCTTGTAGCTGCCACAAAGTTGCAGGTACTGGGATGATATCAAGTTGAAGCGCTCCGCTGTCTGGTGGTTGTGGGCCTCAGCTTTC
AGGAACCAGTAGAGCAAGTAGCCGATTTGCGGAGGATTCGTCAGTGCTCGCATCACTAAAAAGCGAGCAAGTGCCGAGTCGTGATAACGTTCATTCTTCA
GCGCCTGGACGAGTTGAAGGAGATACAGCTGAAGACGATAATCAGGCAGTGCGTGCATGCAGCGAACCGCGTAGGCTCGCACTTTTGGATCCGAATAAAG
CGGACTCAACAGCTGGAGAGCTTGCAGGTACGTTGGCTGCTTCCAGTGCAACAGCAAGCGATAAGCTTCTAACACTTGCTCTCGATTCCCCCACTCGACG
GACAGTAGGAACGCTGGCAACAGTGCGGAATCTTCCGTCAGCATCCCGCGTGAAGTCCAAATGAATGCCCGATCTTCAGAAGACAATTCAACGAGAGGAT
CTTGCCTCAATCGCTGTAAGAGTTTCTGCTTGTCCTGCGGAATGTTCTCGAGAGAAGCAGGATCGTGAGGTCCTGGCTTCTGCTCACCTCCTTCTCCATT
GAAAAAGATTGATGCACGAAAAGCGATGCTCTTTCTCTTAGTAGACATACTGGAGAACGCAAACGATTGAGGACACGACCCTGAACACTCCAGTGCGATC
TCCATACTGCCAATCTTGTGCTGGTTGAGTTTATCGTGTCGTAAGCAGTTCTCAATGTCCAAAGGTGTGATAACACCTGATCCAGGAGGTAGCGTCACGA
TATCCATCAGCGTAGTTCCCGTTCTTAGGGTGTGTCCGAAGTCAAATAGGTGGAGACCACTCCATCCAACGATATCTCCCGTCTTGGTTGTAAAGGTGAA
TCTCAAATGGGAGCCGTGAGGCATGTCGATGAGTCGCAGCCCCATTTCGATACCACCGCTTGGGTCGCAAGTGACCTCACGAGTTGAGGAAGAACCGTGC
TGTTTGTCTCCACTCGAATCTCCGTGCGGTTCATTCCGTAGCAAAGTACTGGTTTCATACAAAACCGTAGATCCATGCTGAATGCTGATTTTCCCGAGTG
AAGCAGTCTCCGAGAGATTCAATTGAACCTTGCCGATATTCAGAACGAGATGGCGATGGTCCTGTGAAACGGGTCCTTCCGGTGGAGAAGGGAACATTTC
CGAGCTTCTTAACTCGGTGGTTCCAGGCGTTGTTGAGTTGGCTGTTGGAGGCTGTAGTGGTACGGAAAAGAATCGCTCGTAGTGGAAGAATAAATACCTC
CCAATTTCCTCTGTCACCAATTCGAGGATGCAGAAGTCGTTGCTGGTGGCAGAATTTACTGGCACTTCGTGGTCAATCGGGTCGATTACAACCTCTAAAA
TGCCCACGATCTTGGTAATACCCGTTGACCCACCATTTGATTGCAAAGCATCGAATTCGAAGAAGGGGGCTGCCAGAATGACAGTGTCCGGTCGATACAA
TTCGCGAGCCACGTTATTTTCATCCATCTGGTCGGTTAACAACTCGGCAGCGTCTTGGATGCAAATTGGCCCGCCCTTTTCAAGAACGCGGTTACCAGAA
CTGGAAGTAACTCCGACATTTCTTGTCGATAGTTTTTCATCCGAAAACTGAACCAGCAAAAGGATAAATTAGTTACGAGCTGCGATGAAAAATGAGGTGC
AGTACCTTAATGACAAGTTGCTCGTTGAGGTCGTCGAGTGCGTAGATTCGCACTTTGCGTGCCGAGAAAATCGAAGTTAAGGCATTTTTCAAGTATTCGA
GGGTGTGATCCAGCTCGTTCTCTGGCGAAATACTCGGGAAATGGTCCTTGCAAAAGGTTTTCACAGAGCAATTGGCATACCCTCCAACTTTCGGAGCGGA
ATTCTCACTCTCTTGCCGGATCAAACTGAACTGCAAGGCCCACTTTTTGAAACTCTCCATCTGCAATTAGCATCAAAGAATTGCTAAATTTCAACTAAAA
TACCGCATGATAAAGCAAAGCTACTGTACCTCACTGGCCTCCTGAACCAATTCATTTTTATCTGCATCGATTAGTGCGCAGCTTGCAGCATTGAGCTCCA
GAATTGTCTACCATCAAAAACATCAGTGACTTTCAATGCTAAAACATTAAATAAGTCTATATGCCTCACCTTCATGGGTATCTTTAGATACTCTGCCAGC
TCCATCGCAATCACCTTCATATCCGACGATCCATGGATGGAGAAGTAATCACCAATGCCAAGTCTCAACTGCGGATACAATGCCGCCTGTTTCACTGCCC
TCGCACTAGGAACGGAGGATTTTGACAATGCCAAATTGCCACTGATGACAATACAGAAATCCCCTTCTTGTTGCAGATTGGCATTTGCAATTCCCAGCGA
TAGGGTTTCGCCTGGGCGTAAGCGAACGCGACGACTGGCTGCAACAAGAGCCTTGATTTCCTCGGCTGAGAGCGTATTGAAGTACGGCACGCTGCAGATC
AACGACGTCGGCTACGTAACAGCTCTAATTAGTGACTAACAACGGAATTCGGACATTAAATTGTCAAATTTCCAACTTACCGAAATGTTCTGCTGCCGCA
ACTCGATATCGTTTTTCGTTCGTTCGTTGCAGTCCCCGTTAACCCGCTTCATGAACATGAGCTGTCGGAATGCCAGCTTCCACTTGTTCTCTTTTACATG
GGGCCCCGGTGGTTGATTCTTGTCAGATTTCGCAGTTTCCAGATCTGCAGGATCAGCCGGACGCTCTTCTTCCGAAGACACGGAGACTTCAGGAGCAGCT
TTCTCGTCCTTCACGGACAAGTGCATATCGCCTGGACTCACCACATCACTCATCTTAGCTTCAGCGTCCTAAGAAGCGAACGAGGAAGTGTGGGGCTTGC
AGCCGTCGCTTCAGCCACGTCCGTTACGCTAGACGTTGCCATTCTTATCGTTGGAGGTTATTTTTCTTGTTTTGCTTTTTGAAAAGAAGAAAAATAACCT
CAATTGAAAGAAAGCTTTTTCTCTGATATGATTTTTTCCTACTTTTGAAGTAGGTTGATAACAAATATCCCTAGTTATTTTAGCCAATCAGTGATAAGAG
CATTATAGAACCTTACAAAATCAGGCGAGCAGGCAGGGGAGAGCGTCTCCGACTGGGGTTCGAGCACCACCATGACATTTAGTACGCCGCCCTTCATCCA
CCTGGGCATCGACGCCAGGACGGGCAAGTCCTACCACATCTGTTCGCGCAAAGTACGTTTCAAAGCGTCAAGTAGTAGCCACAAACGACATTTCTGTCGC
CACTGGAGCTCTTGGGCTATGAAGATGCCAGCAGCAGCTCAGAATTTGCCTATTGTTTGAGAGCTAACCTTTAATAATTGCTATTTCATTGCTACTTTCC
AGTCACTGTTGTCTTTTGGCGCGATCCTATTGCTTCTGGTGTCCATGTCCTCCGAAAGGTTCCTGTTCAAGGTCCTGGTGGACCGCATGGAGTCGTACAG
GTGTGCAAAGGTGCAGTTATGGTCGCTATTAGAAGTAGCTATTAACTGACGATGTTTGATTCTTTGATAGATACTTTTTATGCCAGCTCATGACGTTCCT
GTACATTCCGCCAATGTTCTGTATCGTCAGCTACAAGGCGACGCATGATGTAGGTGTATTGGAATTGGTTTAAACTGGGAGAAACAGAAGAAGCTGACTT
CGTTATTGATTTTTATTGAAGGATCTTATGGAAGACGACGGAATGGAGTTCCCGAAGTTTCACTTTTTCATCATGGGGCTGCTGGATCTACTTCATGTAA
GATCTCATTGCTCACAAGTGTTGAAGTTGGACGATCTAAGCACTCACAGATGGATTTGCATTTACTACTCTACATGTAGGGCTTGATGCTCTTTATTGCC
GGCGGCAGAACAGACCCAACACAGACTCTGCTGTTCATGCAGGCGTCAATTCCGATTTCAGCCTGCATGTCAGCAGTATTTTTCGGTGTCAGGTGTGGTG
CAATCTTGCCTAAATCCCCATGCATGCTTGCTAATTTTTACTTGCTTTTGTCAAAAAGATACACGCGACCTCAAGTTATAGGCATGTTAATTATCACAGG
CGGCCTCGTTCTTTCGCTGATTCCTTGCATTGAAGAGTACGCTTGCCCATTTGCTTTACGTAAGTATTATTTCAACTACTAACGATATTCTGTATGCACA
GCATTCAAAGCAGACAATTTGAAGACCGAGAGATAGGCTGGAACAGGTGCGAGTGAAGTAAGCTGTCTTCTGCGGTGAATACTTGGTCTCACACGTTTTA
TCCTAGTGTATTCTACCTTCTCGCAGCGATTCCGGGTTCATTATCGATGCTGTACAAAGAGCGCGTAATTCGAGACCAACCAGTAGACATGTCGTACTTG
AATGCGTGGGTTTCGGTGAACCAATTTATTGCTGGATTGCTGGCGGCACCGCTCATATTTGATGCCGAGGTAAGTTGCACAATTGAAGTATCCACCGGGG
GCGTTTAATATCTGACGAAATTTCTGTATTTGCCACGATAATTAGTTTCTCCATCTCGACCAGAAAACCAGTGGCTTGATGTGTTTGATTCAAGGAGAAA
GCGAGATCTCCACGGATCACTGCTACGTAAGTTGCATTTTGAGTTTGGATCCTTACTGCAGTTCGGTCACTAATTTTTGTGATGCTTCACTTACTCAGAT
GGGGCTTCCGATCTTACTCCTTTATGTCTTGAGCAACATCATCGTGAACCTTCTACTCCTGCAGCTGATCCGACTCACCAGCGTCTCAACGATGTACGGA
TGCACGCTTGCAGGCTTTTTGACTTCGTTCGTAGTTCTCGCATGGTACCAAGTGGACCCGAACAATTTTGGCATGATCAACCTCCACGACGGTCTGCGGA
ACTGGATCCCTCCATCAGTGTTCGTGGACGTTTTTGCGTTCCTGATCATCTTTGCCGGCAAGGTATTGTATCAGTGGGACCCGGATCCGGAGGTAGAAGC
AACTACTTTGTCTGCAGAGGACAAGGAGGCCATGTCGTTACTCGACGGAGAAGACGAGTACGGACTGCGGTACACGTAAATGCTCCACTTCCAAGAAAAT
TAGTTTATTATACCAGAAACAGGAAGTCAAAGAGGAGCAGACCTATCGCCACGCAGGACTCGGACGTATTGTACATTTTCAACGTGCGGGAGGAAATGAA
ATCCACACAAATCGTGACGACGGCCCCAACCACAAAAAGTCAAACGGAATTTGTTTATTGTCATCCATTTTATTGAGCCGTTGATAACGGTCGGTTTATG
GTGTCAAAAACTCCTCGTCACTTTGAAACACACTTTCGAGTGACGATGTCGGTATCGCTGAAGCAAACGACGGCGTCGCGCCTAGCCAAGACCAAGAAGC
CTCTGTCCGAAATGCATCAATTGCAGCGTGCAGTGAAAGAATTGCAACGCGAGGCGGCCGACCAATTAGTCCTCGAAGTGGAGTCGCAGGCGACATTCGA
GTTTCTGACCTCACAGATTCGTGCTCTACGGGGTGCCTTTGATACTCTTTCGGATGTTTTAATGGCCGAGGTGGATGGTGTTCGCAAGGAAATGACCAGA
AAGGTTAGCGACTTAGATGCAGAAGTGGCACGGCAGGGGGAAATGCAGAAAGCCACACACAGTGAAGTGATGCAGCTCAAGCGGACGATGGAAATCTGGG
GGTTAAAAGAACGTGACTGGGCAAAAGACAATGAGATCCTCAAGGCGTCGCACAGTCACAACGTGGAGTGGATGCAGCAATTGCAGCGCGATGTAATGGA
CGTGAAAGACAAATTACACGAGATCAAAAGTGACACAGGTGCTCGGATCTCGGAAATTTGTCAAGAAGCAAATAGTTTGCGCGGAAATTGGCAAAAGCAC
GTCGATGATATGCTCGATCGTCTACACGATTTTGACACAATGACGCAGAGGCAAGCAGCGGAAGGACGCGCTCAGGCCCAGCAACGAGCAGATGATCTGG
AACTCATGGAGCAAGCGCTCAGTACTGTCCAGAAGCAGCAATTGCAGGTACGTTCTGGACTTGAGGAGCAGACGCATAGTGTTGCATCGCAGATCGCTCT
GTTGGGCAAGAAACTCGAGATAACACAGACGCAGGCAAACGGTCAAAGAACAGCTCTAGAACAGCTCCGAGCTAAAAACGCGTTGATGGAGAAGGAGCAG
CGTCGAAGGATGGATAATATCGGCAAGATGTTCACGGTACGCCGAGTAATTTCTTCTTCCTAGTTTTAAAACCTGACGGATTGAATCTTTGCCTTGTGGT
TAGATTTTTGCTGATGCTCTCAATATCTCGCCGACGATGCTGGCAGCAGCTAGTTAAGGAGAAAACGTTTGGATTTTTTTTCGTTCTTGAGTTTCTATTT
CAACACAAGACTCCCATTTAGCGCGAGTTCATCTCAAGCGAGATCTGCTGCACAGCCTTGATGAAGGCGTCCACGTGGGCCGGTTCCATGTCCGGGAAGC
AGCCGTGGCCCAGGTTAGCCACGTACTTCTGCGTGCCGAAGCGCTTGAGCATCTTCTTGACTTCGTCGCAAATAATTTCCTTAGACGCGTAGATGACGCT
CGAGTCCATGTTGCCCTGCAGCGAGACGCGGCCACGCGCAAGTTGACGCACCTCCACGGGGTCGGACTGCCAGTCCAGGCCAATACAGTCGTACTTGGTC
GCCACAAGCTTCTCGTACGCGTACTGCGTGCCCTTGCAGAAGCAAACCATCGGCGTATCAGGCGCCTCAGCTTTGACACGGTCTGCGATCTGGACCAGGT
ACGGGAACACAAACTCGTAGAAGTGATCCTGGGTCAGGACTTCGGCTCCGACACTTTCAAAAACCTGCAGAGCCTGAGCACCGGCACGCTGTTGGGCCAG
CAGAAAGTTGACACACACGTCCGTGATGCCTTGAAGCAGCTTGTGGGATGCCTCCGGGTGCTGGTACAGGAACGTCTTAAGCAGAGCCTTGGTGCGACTG
CCACTGCCCTCGATCATGTAGCACATGAGCGTGAGCGGTGCGCCCACAAAGCCAATGAGCGGGACTTCGCCATTGATCTTTTGACGAGCCAAGTTCAACG
CGTCCAGCATATAGCCGAGCGTCTCCTCGATGTTGGGGTTCAGGTCCAGCTTGTCAATATCCTCCGGCGTACGGATCGGGTCGGGCAGTACAGGTCCCAC
CTTGGGCACCATCGTGACTTCCATGCCCATGGCCTGAGGGATCACCAGAATATCCGAGAAGATAATAACCGCGTCCATTTGGTAGCGGCGCAGAGGTTGC
AGACTCACTTCCACTGCGAGCTCGGGCACGCCGCACATGGTGAAGAAGTCGTAGCCCATGTCTCTCAGCTCGCGGAACTCCGGCAGGTGGCGGCCAGCCT
GGCGCATGCACCACACAGGGACACGCTCCGTGCGGTCGCCACGTAATGCGCGGAGCAGCAGGTCGTTCTTGAGCTTCGGCAGCTGGTCCAACGGCACGCG
GTCGAGCGGCGTGCGCGTCATGGGGAAGGGCAATTCCTTCTTCTTGCTGGTCTTCTTCTGCTGGCGCTGCACGATGTACGCGGCGGCTGCAGCGGCCGAA
ATGGCGACGGCCAGGGACGTCGTGACTTCGCCTGCCATTGTTGCGGGGGTCCGTAGGAAGAGGAGACGATCGACTTGTGCCCAACAACTGTGCGTAGCTC
TTCGGATGTGGAAGGTGGGGCGGACAACGGGTGAATATGTGATTGGCGGATAAAGAGACATGATATGGAGAAATACGATTGGATGGAGGCAGATCTTTTC
AGCGAATGATAAGGCTGATATTACGCAACATTGTGTACACACTGACCACTTCAACTTCAGTCCGTTTATTTAGCCCTTTAAGCGACAGCGTTCTACGGAC
ACTACTGTAGAATTCTCTACACGATAGTGGTCTTCTCTCCGAGGACTGCCCACACCACCTTGTCCTTCACCACCGGGTCCGACGCCAACTTGGCACGCAA
ATCGTCGCCAGCCTCGGCGAAGTGCTTCCACGACTCAAAGTGCAGAGGTACCATCTTTTCAGCACCAGTGTCACGGGTCAAATGAGCTGCCTGCGCGCCG
CCCATAGTGACTTGGTGAGAACCCGTCGGCAGCGGGACGGTGGCTTTGCCGAGGTTCATGAGCGCCACGACGATGTAATATTTCTTCGGTAGCTCAGTTG
CCAGCTCCGGAATGTGCACCGTGTCACCTGAAATGTACACAACGTTTGGCAGACCATCCGCCTCGTTCACGCCGAACGAAGGCGACTCGAGTACGAAGCC
CGTGCACTCTCCACCAGGGAGGTGCTGCGTGGGCGTTCCTGTAATCTTGAACTGCTTGCCGTTCAGCATGAGCGTCGCGGATTCCCACGGCGCGAGGCCG
CGAACCCCCGGACGAGGAGCGAGGTTCTTGGCACCGTCGAGAGTGGTGAGGATGTGTCTGCCATTCAGCATCGTGCGGCCGGACGCGTCCAGGTTGTCGA
TGTGGTCTTCGTGGCTGAGGAGAATGGCGTGAATGACGGGCAGATCTTCGAGTCGGAGGACCGGATCGTCGGTCTTCGTGAGGACGAATCCACCCTCTTG
CTCGAAGTCGCCTTTCTTGTCGAAGGTAGGGTCCAACAGGAAATTGACGTTGTCGATAGACAAGATGGCCGCGGACGTCGTGATGTGCGTGATGCTGACG
GCGGACTGGAAGGATCTCAGTTAGCTGGAGCTTGGTAAGAGGGTTGTTGGTTGCGAGGAAAAATGTGGAGTGATGCGATTGATCTGCTCTGCGGCCTATG
AGATATCGCTGGCATTCGTCTACACTCCGGTGGTACAGTATTCATGGATAACACATGTACTGTATGTAGCCCATGTATTTTTTTTCGGTCGTAATCGTCG
GCACTTGCCGAATGTCGGGTCGAAATACCCGGCCGTCATCAACCGTGGTGAACAGGAGTTGCATACGGGAATTCGTAAAGTGCTTAATCCATACTTCGAA
GTACATGCATTCGTTGTTGTGTGCACTCGAGTCAAAACTGGGCAGTTCACCGGGTTCTTTACCACTTCATCGCTGGCTTCAAATAATTTTAGTCAACTTC
GCTGGTGCTGCAGAGTACATGTAGAGTAATTGACATGTACGAGACTGCAACTTGATTCACTTGGGGCTGTGTTCTACTACGTAGTACTTCGAAGTAACTT
CTGAGTACATGTACTGCCCGACCAAAGTCTCTACAGCTCCGTGGGAGGCTGAATTTGGAGAACGCTGGGCACAAGCTCAATGACCAGAAAACGCAAATGG
CATTGGTCGTTTTGCTCTTTTTAAAAAGCTGAGTTCCATTCTTCTGATCTATTCGTGTGATCTACTCCATGCCTACCGCTAGCTGTTTACTGCCAACTGA
TCACTCGAAAGCGCCAACAGAGTTAGTGGCATGCTTACAGGAGACCAAATATGCGAATGCAGGCCTCAACGGTCAAGATCACATTTCCGAGCAGACCGAG
GTAGCCTATGCCAGCATCAAGCACAACACAAAGTTAGACCTTCCAGTAAAAGACAAGGAAACACGAGGAACAGCACAGCACCCACCGAATCCGCCCTGCA
GTCTCTTCTTCGGGTCGCCCGACGAGTAGCCACGCATGTACACAATAAAACCGAGAATGCGCACGAAGCTAGCAATAGCAGCAATTTGGGGACGGTAGAT
CCTGCATCAAATTCGTAGTCAAGCGCGTTAGGGAAATTGTGTTTACATGTATGGAGAGTACACCACAACTTACGACGATGTGAAGATCAGCGCGAGGAAG
ATCGGAATGTTCTCCATGATGTTCTGGTGGCCACGCTGCACGCAGTTGAAGGCCTTGGCGTTCTTGTCGCTCTGCTCCGCGTACATCTAGACATACAGCA
ATGGTCAATGCTACACACCACGGAGCGTACAGATCACTGCGGTAACTCGGGACGTACCTGCGGGTACTCGACGCCGTAAAGCTTGCGTGCCTTTCCCACC
TTGACACCAGCCCACAGGTTCACAAACAGCAAGATCACCACGAGCAGGGGCACGAAGCCGTGGGCGGGTTGCAGCTCCAGTTGAATTCCAGACATAATGC
CGCTTTGTGTGGTTGCCAGGTCGAATTGGATTGTGTCCCGCAGTTGGATTCCAACGGCGGGAAAGGTCCTCTATTTGAAGCAATCGATTGCGTTATCTAA
GAACAGTGCGAGTCGCACGGCTCTTCACGGTTAAACTACCAACATTCCAGCAGCTTTGTGGTTATGGCAAGGTGCGCCACAATCCGTAAAGTGAGGTGAG
GTGAAGTGACGTGACGTAGGTAGGGCACTCATAAACTAGTGGAATGAAGGTGGTCTGCTTTGAGGTTTGCATCAAGTACTGGTGGTGCACACAGCAAGAC
CGCACGCGTCATGAAAAAACTCAAGTCTAGAAGCTTTATCGATCCATCAGTTAAATACTAGTACTACATGTAGTAGTTTGATCACGACCGAAAAAGCCAC
AATAACTTGAAGAATGATCTTTTAAACTCAAGCGAGTCCACTTCACGGAGTACGGCGACGATGCGGCCCCGTTGGTGAAGAAAAAGGTGGCGTTGTTGGT
TACTGGTGAGACCGTTGTCGAAGACCACCGTCGTGTTGCGATAAGATGATCAACTCGTTTTTACAGGTTCGTGGAGTAACGTACTTCAGTGAAGTACCAT
CACAATGGGAGGGGGGGGGGGGCAGAATTGCGATATGGTACAAAAAAATCACCAGTTTGGAGGAGGCAAAATCACCAATCCTTTTTCAAAAATATCACCC
CGGTCAAAGCAGGTCGAGGTGTATCGGTCAGTGTGGTCATTTTGTGTTGACCATCACTCCTCAACTTCAACGCGCAAAAAACAAATTGAACTGCAAGGCC
ATTGCAAACTGCAGCATGCCTACGCGCCCAGCACAGGCCTCCGCGTCTAACACTGCTGCCTGCAGTGCTAGACGCGGAGGTCTGTGAAGATTTCGGGTTG
CTTGGCAGCCTGTTCGACGTAGACGCAGAGCTATAACTGAACTTGCTGCATGCATTCAACATGGAAGGAGAAAGGATAGGTAATGGTTTGCGTGGCGTAT
ATTATCCGGGCGATAGCTTAAGGAACATGCGCTACTCTACGCTACGGCTCACCTTCCGTAGAAACGCGGTTCTTCTTTTAGCGAGCGTCGGGCTTCTTCT
TACAGTCGTTAATAGCACCGACGCTTGCTTCTTCATCTTCTTGTTGTCCTCGGCGTCGGCGCTCATCGTCCGCTGCATGTACACGTTAGTCATGACTAGG
GCAGGGGGCAGTGGGCGTGCATACTTACCTGCTATGCGTAGGAGCCCCAGCTTTCCAAGTGCGCGCTGCAGCCAAAAAAAATCAAGACTGAAGGGAAACT
TGCAGTTGCGGAAGGACATTTTGCAGAAATGTCTGACCATTTCCGAAATGGTTTACCCAAACAGGTGAACCATTTCGGAAAATAAAATCACCACTGACAA
AAAAAATCACCAACATTTCGGCCACAAAATCACCACCAAAAATCTAATTCTGACCCCCCCTAATAGTTTTTATTTTGTTGTGTACTATTACATTTAGATA
GATACGTTCACGTTTCGTGAAAAGCGCGAAAGACTTAAGGCCTTCTATCGTGTGGCAAGTAGGACCCTTGGCTGGTCTACCCGATCCCCCGCTTCCGCGC
TGTTTAATGTTTCATTTCATAGGCATTTCGGCAGCAGCTTCCAACCGTTGCTACTGAGCCTGTCGCGGCACTTTCCCTCGGATGCTCGCAAATGTCGGCG
TGGATTGCAACACTTCATGACACGTTTGCCTCACATTACCTTCGAATCGGAGGCTTCATGAGTGTGCTTGCCGACTCTTCTTCTCTGTTGATACTTCTCT
TCTCGATTGTTTCCTTGTCATTCTCGGTGTCGCTATAGGAATCCAAAAAGCCGCAGAGACGCTTCCAAAGAGAGTCCTAGCATAATAAGCGTTCCCAGGT
AGCCTGTCAAATAAGCAGCAATAACCGTTTAGCGACTAGGATACATGATACAAACATCGCAAGTCAACGAACTCACCAAAATTGCCTTTTCTCCTTTTCC
CTGGGTCTCCGGTTGAATATCCCTTGACGTACATGATGAAGCCAGCGATACGCACCACACCTGCTGCTGCTGCGACTTTGGGACGGTAAATTCTGCATCA
AACCAAGGCAATTGTCAGATTCTAAACAGTCACTCCTAATGAAAAATGCTGTGATACGTACGAGGAGGTGGCGAGCATGGCGTAGAAGAGCGGGAGGTTC
TCGAGCACATTTTGGTGCGCGCGCTGCACGCAGTTAAACTCTTTGGCGTTCTTTTCCTTCTTCTCGGCGTACATCTGCGGATACGGGACGTTGTATTGCT
TGCGGGCCACGCCGACCTTGAAGCCGGCCCACGTGCCGACGAGGCCGGCGCCGATGACTACGAGCGGGATGTAGCCATGCGCCGGCTGGAGCGAGATTCG
CACAGCCGATACCGACATGAACAGGATAAGTTGGCGCTTGCTGGGGATTTCCTGAGTATTGCGGGGCTTGAGGGGTGGAAGGCAAATTCCGTTATGGGCC
GCTGCTTGCAAGTCGCAGTTTGCCACGGGTTTGATGCAATGAACCGCGACGGCCTAAGATCGTTTCTTTAACAAATTTACCGTAACCCTTCGGTCTGGAT
ATGTACTCTTGAACAAATAGTGGTTAGTGCGGACATAATCGAAGGGCTGGTCTGATTTTCGCGGTTTTGCCATGGCAGATGATCCTGTTGGCGAAAAGAT
ACGAGGAGACCTTCAATTTTTGACCGTTTCCAACGAGCTGATTTTTTGGGGTTCTTTTGGCCTTTGGTCAACGAAGCAGGAGCGAGTACGCGTGCACGCG
TTGACCGACCGTTAATTGCACGGGGCAGCGTTTCGTCGAGAACACCGCGACGAAATATTCTCTCCTGGAAGTGCCGCCACAAAGTGAGAGACCGTCTCAA
AGCCGAAAGTCAATTGTTGTGTTGAAGTGTCCCTCGAAAAGTACAGCGACGAAGCGGCACGGAACCTTCGGCTAACGTATCTTTCGTCGGACGCAGCGAC
ACTCTCGTGCAATTGCATTCGCGCCGTTGTTGGCGTATCGGTTGCTGTCGCTGGAGCGTGCCGGGCGTCACCACGCTTTGCATCATGCATGATGTGGCGT
GGATAACTTCCAGAGTCTGTCTGGTAGATAACGTTGTGCAGTGCAAGGTACACAATGTAGTTTGTTCTCGTTTGCTACGTCTCCGGGTCTTGTCATTTTT
GTGGATGGCAGCGAGAAACACGCGAAATCCGGCGATGGGGTGCACTGCACAGCACTGCAACTTGCGGTGGACTTCAACCTGCTGGTCCTGGGAAGGTTCT
ATTCTTGTCGACCACTTCAAAGGTTGTTTCGCTACAGTGCACCAGCTTTGCTCTGTCGCTGTCATCGGCGTCTTCTGTGAGGCCGACCTAATCGACATGG
CTGCGTACGTTGAAGCGAGAATTAATTCTACCCCAAGTAGAACTTCGTAGATAGTTTTACTGACTGACTGACCCGACTAATTCAGTGCGGCGGTCAAGAA
GCTGTCGCGGTATTGCTGCAACAATTGCGGAGGGTCCGAGCTGTACCTGTACTGCTGGGTTAGTGGTGCAGCTGAGGGGTTGTAACTGATATCGTCGAGT
TTGCTCGATAAACTGAATCAGTTTATCTGGTGATGGTGTTGTGCTTTCGGGTTGCAGAAAGGTTGTCGGCACGTGCAAAACATCAAGGTGCGCGCGTGCC
ATTTCCCGGCGTGCATGAGAAAGAGGCCCCTTCTCATGGAATGTTGGTCCCTTGCGTTTTGTCGATTTTTACAGACCTTTTACGCCGAAACCAAGTCGAT
CCAGCAGGAGCTGGACATGCTGCGCGTTACCATCTACGAGCAAGAAACTCGATTCCGCGAGTATGAGCTTCAGATGGTGTGTACTAAGAGCTTTCACGTG
TGCACTTTCAAGTAAGCTGTTAATTTTTCATTTTTGCTGAGGTGTAGAAAGAGAAGCAAGAGAGCTTGGAGTTTCTTGCAAACCAAGTAAAAAAGCTCCC
AAGCTTTTACCCAGTGCAGCCGTCCGACAATCAAGCATCGATTCCTTTTGGTTTGCCATCGTGGTCACTTATTGCTGTCAAAATGGTGTGGCAGCAATTC
GATGGAGACCAAGATGGCAATTTGACTAGTGAGGAGCTGCGTCAACTCAAGGTCGGGCAATAATGATGTTCGCAACTACTTCGAAGTACTAATCTCTATC
TGAACTACAGAACCAACTTCGAACAAATCACGAAAACGTTGATGATATTCTTCCAGACTATCCTCCTGAGCCGTTATCTCCTCAGCGTTTTCTCAAGCTT
TACGAATGTGGTGAAGGCGCTAAGCTGTCCGACGATCTCCGCGCTCTTGGCATTTTATGCGGTAACGAATATGCTAGTGACGCTGCAAACGCAAATCGAC
ATACCTAACTTGTCCCTGTAGGATTGTCGGAATCAATCGCTGAGTCGCTTTCAACTTGTGATGCAACGCTTGCACGTATAACAATGGAAGCTCGGGTACA
GTAATAACAAGTTCTGTGAAGAGCTGACGAATGGCCAAATGTTCACTTGGATTCTGGGTTGGGATTTCGTAGCAACTGCAAAAGGAACGTGACAACTTTC
AAAAAGAAGTCGAAGAGAGCAAGGAGAGTTGCCAATGTTGAGTATGGTGTTCGATTCGAGTAATAACATTCGCATGTTTGGCTTGGACACAACAGAGAGC
AAAAACGCGCTTACGAGAGGTCTTCGTAGCTTCTAAGCAATCTCTTGAAGACAAAACACGTGATGTCCTTCGATTGCAGCAAAAGGAGACCGAGAATGAG
CTGCATCGTCGACTTGTCGAAGAAAAGGGTATACCGTACTGTCTAAAGCTCCCTTCCTACATGTATTTCGCTATCATCTAACGTGTTCCGTGAATATTTA
CCAGCTGCAGTGGACGCCACGAGGCTGTCGAAGGCAAAACGCGACTTATCCTTAGCAAAACATGCACTTTTGGACTTGAGAGCGCTAGTTGATGAGTAAG
TCCACCTCGGATTGATCAAGCTATCGCTAACATCGTTCTCACCGCCATGTTTCTTAGTCAAATAGCTGAAAAAGAGAAATGGCAGCGATATTGCTGGGAA
CTGGAAGGGCGGCTACATGAAGCTACAAATACCAGTCACATCAAGGAGGTAAAGTAGTGTTAGCTCTCATGTGGAACATGCAGTGTTGATGAATTATTGT
AAACTCTTTGTGCATATTTACCAGCGCGATCTCTGGCGGACCAAGGATGCTAAGAAGGAGGAGAGTCGAAAGAACATGCTCCTGTACATTGAGGCCCATA
AAGGCAAGCGCCACTATTCTCGCGGAGCTGAACCTACAGACGATACCAGTCTCGAGAGCAGGCCTGTCAACGCCTCAGCAAGCCCTGAAAAGAGTAATCG
CAGCCTAACACCACCGGGAAACAATGGCAACGACACTCCCAGCCAGCTCAAGACGCAACAGTAGGCCTGATAACAGTGAATTTTTATACAAAAATACATG
ATCCCCTCATCCAAGAAATGGTCGTGTCACTGCCTCCCTACGCAGGGGGAGTATGAGAGGCGGGGCTCTAATGCACTCCGGTTAGTCGTCTAATCCTCGG
GGAAACTACCAACAGCGATCAAATTTAGCGACGGTGCAGCATCTCACACTTAAATTCCCTTGTTGTAGATGAATTGGCGGACAGGTTGGCCATGGCGGTC
CACCCGAGACCGAAACTCCTCCTCCACACTGTCGGCTGAGATTGTACCCATCTGCGGGAAGAGCGCGACGGCGCTAGGCATGGCACCCCACAGGCACAGC
GTCAGCACCACTGTGTGAACAAGCACATCAGGTCAGTCAATTCAGTTCATACGCGAGATTTTAAAGAAGGTAGCTCGCATACCAAGCTCTGCAGCAAGCT
TCGGGTACTTCGACTTGGGCATGATGTTAGTCTTCTTCATGACTTCATACAGGTACGGCGGAAGCAGCAAAACTGTTTCATTCGGATTCACGAGTAAGTA
AAACATATCTGCGCAACTTGCAACAATCGAAATGATAACGTACTAGGCATGGGAAGCGCAACGCGCGTGAGTGCCACCTGTCCAAGCGACTGCCGTCCAG
CAGCAACCGAACGTCCGTGCACGTCTCCGTGCTCATCCATGATATCAATTCCTTCCCTGCGAAGCACCAGCACATTCTAATTAGCACACAGAATATATCG
CTTAGCGCGTCGAATGCTCCAAACGTACTGGAACTCGTTAAAGCGCATTGACACTGCGTTGAAAGCACCCGCGCTGGCAACAGCAACGAAAGGAACCATC
TAGGAAGACAAAACATACACCCAATTAGCAGTTAGGCACAAAATTATAAACACTAAACGCTGCGAACGCACCTTTCCGAGGAACGAGCGAGTGCTAGGAG
AAAGTCTCTTGGCCTTCTCCACCATCTTGCCCAGTCCAACGGCGGTCGTGCAAGACACCAGCGTCGCGGTCGCGTACGATTCTATGATGGGAAATCAAGA
CAATTAGCTCTCAAACAGCGCAACTTGCAGTTGGGATTACGTACTGAAGATGGTCGAGTTGTCCTGATCACTGCTGGCGTTACGGTTGGCATAGTTGAAG
CCGGCGCTGTAGCTCTGGTTTACCCACTGCCAGAAGATCGTGTTTCCCAACTGCAATTAACGCAACAAATTGTGATTAGCTGCAGCTACCATTCATGGAA
TGGAGTTCCACAAATCGATATACCGTAGGAGGAGCAAGCAGCATGCCGACGCAGATAGGAATATTCACAGGCACGAAAGCTGACAATCGGAACGCAGCGG
AGACCGTCTCGCCAGTCTGAGGGTGGACTGCAGCCTCATACGCTACAATCATCACGACACAAGTTCAGTACAAAAGGTTCCGATGTCGCAACCGAATTAT
CCTTACCTTGACGAAGGTTCCAAAGCTCTGCATCTTTGAATTGACCAGGAGCGAGTTTACCATTGCGGAAGTCCTCCAGAGTCTGTGTCGCGTGCTGAAT
CTGCTCAGAGGTCAGGAAGAGCCACCTGCACCATATCGTAAGAATCCGCCGTTTGCCAAATCAAATTCTCGTTGACGTACTTTGGCGAAACGAGCTCTGC
AAACTTGCGCCACCGACCGACGTACGTCGAGGTGTCGTATCGAGGCTTATCTGGTAGAAAAGCAGGATGTTGTTATATAACAAGCACAGCAAATGTTGCA
TCAAAAGCTCCATTACCAAGCGAGAATGGAGGCACTTGTTCGTCAGACATTGCAGGGACTTTGCTGAGTTCGATGCTGCACGTGCACTTGTTGCAGTTGC
TGAGATTTCACGAGTGGGAACAAGCCAGCGCCAGTATTGCTTGGTTGGCTCAGGCTGCACGCATCCTGGGTGCTATCTTGCCTCTCCAATGGAGAGTCTC
CATTCAAGTCCAGCAGCCACGTCAGTGCTCCAGACAGCTGGCTTCGCTCTTCATTCATGATGATTACCGCAGGGTGCTCAAATTCAAGTTCAAGGCTCTT
GTACGTTAATTCAAGCCAACACGCTGTTCATGTAATGCAAAGGTATCATGTGCTTGTGCGCCGTCGGTGCCTAAAAGGACGTCGGCAAGCTGCGGCACGA
AATTGGAGAAAATATACTTCTTCTTGGTATTCTTCTTTTATAAAATTGCAATCGTAATTTTTACTTTTCAAAAGCACGTTTATTTTTACTTTTTTTGTTT
TACTGTACCAAGAAAAAACAAAGGCCGTGCAGTTGCACGGCGAAGCTCTGGATATTCGTACGGTACAGTTACCGGTATTGGTGTACAGATGCCGTTTCAT
GAATCTTTTGGTACCGGTACACCGTAACATGAAACTTTTAGAGAGCAGCGTGTGCTGCAGAAGTAGCGGTCATGCAAGGCACATATTAACACCCAGCTCG
ACGCGCTGCTGATCCACGTGTAGGCCACGTCAGCAAGTGCCCCTGTGCAAGTAGATTGACACCAGGAGACCAGCTCAGCGAGCTGCTGATCACTAACTGT
GCCGTTTAGGTGCAAAATATTTCTACCAAGGTGATTCTTTGTGCAAATTTGTCTGAGATAAGTGAGACTGACGTATTTGGTTTGTCTGCTTTGACGGGCT
TGCGTTCCGGTACTGCTCCATTGAGCTGCATCATGTCTTGAGAGCAATAAAAGAGCACGACATGCAACTTGCACGTGAGTATCCATCATAACTTTATACT
TCTAAAGTACGTTCCAACGCTTATTCTTGGTCGGTTTGTAGCTGGGCACCGACTCCCGTTCGTGGACATGATCACGAACCGTCAACAACGATCGTCCCTA
TTTTCATCAGACTCAAATCGAGGAGGAGCATCTTCACTAATGGGTGAGGTTCTGTACTACCTTGGCTGCTCATTTTCTTGTATTGTTTCACAGAGGTGGG
GAGCATTGAAGAGTTGGGTACTGTACCAGGGGAAACCGAAGTAAAAGAGATTTATTACGTTGAAACTACTTGTAGAGGAAACTCCGTCAATGGTGATCTT
TTGGAAATTGACGACGCCGAAATTTGTGCGGGCCGGAACCATATCATACATTCTAGTGGATCTGGAACCAAGCATTTTGTTAATCCTCAAGCTATTCTAA
CCTCCTGCATTCTGATATTGCTTCAACGTTTGGAGTAAAGTAGGACAGAAACTGCTTGGTTAGTGGAGCCATCAAGTATAGCTGCCGCAGAGTTTTAACA
CGCGTAACAGCTACGTAGAAAGCCGAACGTTGTGGGGCTCGCCTTGTCGGGTGCTTGAGTGGAGCCAGAACCATTTCGTCCACAGTGAGGCCCTGGAATT
TTTCTGTCGTCAGCGAATAAGCTGGCACAAGCGGCACTTGAACGATGTGAACGGAGAACGAGCGGTGTGTCAATTCGATCTTGACACTCTTTCAGCTCGT
TTAAATACTGGTACGACACCAGGTGGGAGCCCCGGCACGAACGAATCCATCTCAAAATCTTTAAGTCGGACGTAAACGACGTCAGGAGGGAGTGAATGGC
AATAAACTTGGATGTCGCCTTCTGTTCGAGTCTGAACCACATCATGGACCGCCGGTACAACACCCACGACAGTCCCTATTGACCCGTTCGCCAGTTTAAA
CTCCGTTGATGCATTTTTGGTACGCTGCACCATTGATCCGATAGCAATCTCCAACATGATCGGCATACCGCCCATTTTATCGTCTCGGAGACTTTGTAGT
GATCGCTGTTGAGAAGCTGAAAGAGGGTGGCGACCTCTCGTGATCGTAGCTTGGAACCGATGCAGTGGCACCTCCGATCCTTTACAAAACGCTCGCAGAG
TCTTCGAGTTGAATTCAGCACGGAGGGCATTCGAGGTTACAATAATTGGGCAATATCCTATTAGCTCCAGACGTGAGCATTTCCAATTGTCGTGGAAAAT
GTGTCGGCTGCGAGAGATTTAGCATGGCGCGTTCTGTAAGCGTCGTGTCTTGGAAAATGGTTGATAACAGTCCAATAAAGAGTCCATTTGCGATTGCGTA
CTTTGGCGGGTGTGATAGTCTCTTGTTCCTCAGTGACCGCAAGCATGGTTTGCAGAAGTTCATCGCCGTGTGGCCATTGAACTGGCTAATTCCAGCTTTG
GAAAGAAAAAGCTTCTGAAATCTCATGTCAATATCTGACAGGTCATAATGACTCACGAGATCGTCTGGTAGATTTAAAGGCATCTGCAGTCGCTCCGTCA
TTGCTTTAAGAAGCCCTTCGTTGACGTCCGTCATCACATCCACCTTCACGATATTATCCACAGTATGAAGACAATCACAAACACCACAAACGAGCTCCTT
TTGTACCCGGGGTGACAAGCGTCTTAAACTTTCTTCCTTCACGCGAGCTTGTA