Description :
From Genome Similarity Track
Location :
Scaffold_144:4777- 6742
Transcript NameFunction/comments
Physo_143568hypothetical protein

Sequence
1965 bases(100 bases per row)
GTCTGCAGCCTGGTTGTAGTCACGCTTGACATGGACCAGTCTGATCGACTTGAACTTGTCCTTCTGAACTTCATACTCGGCGAGTTGGCGCTGTAGGTTG
GGCTGATTACAGTTGATCAGTCCCTGAACTTGCTGAATCACGATTCTGGAATCGCCCACCACGACCAGATCCTGGATCCCACATTCAGACGCCAGTTCCA
GACCCTTCAGCAGGCCATGATATTCGGCGTCGTTCACAGTAACGTCATCCAGGATGAAACCGTGTGCGGTCAGGACGTGCCAGTCTGGAAGCTCCCAAAT
GATGCATCCACAACTTCCTTGGCGCGTAGATGTTTTCGCAGCGCCGTCGAAGCTCAGGACATATCCTTGGTAGTCTGAATCCAGCATCTCCACGCTGATT
ACAGGTGGCGCCTTGACGCGCCCCTTGGCCGGAATCAGGGTTTGAGCAACCTGATCCAGGTGTTCGCGTGGCGTGATGCCTGCTCCCATGATGGCAGCAA
GTCCGTCCTCGTCCCTCTGCACCTTCCGAATTTCCAGGTTCCACTGAGACAGGATGACCCCCCAGCGCACGCACCTACCGTCGGCCGACTTGGATTTAAG
CAGCCAATTCAGGACAGAATACCTTGAATAAACCACAATCTTGGCGCCCTGGACAATAGTTTTGAACACTTCCAGAACCCGCAGGACTGCAACGACTTCC
TTCTCCGCAATGTGGTAACGTAGCTCTGCGTCGTTCAGGTCACGCCCCGTGTACCGGACAGGCTGAATCACCCCATCATATTCCTGGCCAAGGACAGCGC
AAGCTGCCCACTGGTTGGCATGGGGAATGACCACAAATGGCTTCGTCTGGTCCGGGTGTCTGAGCAGCGGAGTTGACACGATCTTGCGTTTCAGGATCTC
AAAGGCCTCCTTAGCCTGGCCGAGGTCTCGTCCAGCCCGGATCTGGTCATCCGTCAACTCGTACAGGACAGCCGCCACAACCGGGAATTCCTCTATGAAC
TTGTGGTAGTAATTCAGGCTGCCCAGGAACGATTGGACCCCTTTCAGGGTCGACGGGAATGGGAGGTTTTGGACACCCTTCGCAATCTTCGGAGTAGCCC
GGATCCCTTCTGCACTGATCTCGTGAGAGAGGTACGGAATAGACAACTTCCCGAACTCGCTTTTAGGCGAGATGTTCCAGTAGCGTAACCGGAAAAGCAG
CGCATTCAGATCCTGGCAAAGCTGATCCCAGGTGGCCGCCCCATGAGCAATGTCGTCGATATAGGAACTTCGACCAAGCACCGGTCCCATCTGGGGTGGC
GTGGGAATGTTTCGCTTGAACACCGTCATGACATCGGTCAGGACAGGCACCCTCTGCTCAGCCTGAATCCACTCCGCTTCATCCTGATCGGAGGGGTCCA
GCTTCAGGAACTCCAATACGTCCGGATCCACCTTGGCCTCTTCCTCGGGTGGCAATCTCACAAATCCCCAGAGACAGTTGTTCAACATGGCTTGGTAGAT
GAGCGGGGCGTTTTTCAGGCCGAATGGCATGTGTACCCACTGATAGTGTCCCAGCGGGCACACAAAAGCCGAAATTAGCTTCGCACGCTCGGTCATCGTA
ATAGCTAAGAATCCACTCGCCATATCCAGACTCATAAACCACATCACACTCTCGAAACCGATCAAAAGGTCGTCAATCAGGGGCAACGGGTAACTCGAAA
GTTGGATGAAACTGTTAACAACCCGGTAGTCGATGCACATCCGGATGTCAACCCCGTTCTTCTTCAGGACGATGACAATCGGAGAGGCCCAGGCAGACCT
GGACGTCTCAATCAGGCCTGTTTCCAGGAGCTTCCTGAGCAGCTCATACACCTTGGAAAACAGGTGCGGGGCAATCGACCGCGGACGTTGGGCAACAGGT
TTCGCGTCGCCCACATCCAGGTCACACACGATCCCACGAGCAGGTGTCGGCGCTGCGTTTCCATC