Description :
From Genome Similarity Track
Location :
Scaffold_1537:4777- 5797
Transcript NameFunction/comments
Phyta_totarag13212hypothetical protein

Sequence
1020 bases(100 bases per row)
TGCAACAGTGCGCAGCCGGTCGCGAAGTCATTAGCATCGCACACCATGTGGAAGAGAATCGAGTGATCGGGAAGCATCAAGGTGGACAAGGTGTGCTTCA
CCGCGTCGAATGCAGCCTGATGTTCAGGACGCCACGACCACGTAACGTTGGATTTCAGTAGCTGTGACAGCGGAGGGGCCGCCGAAGCGAAGTTCTTCGA
GTAGTGGTGGAGGTACATCGTGAGGCCCAGCCACTGACGGAGTTGCTTCTGGTCCTGTGGTACTGATCACGCGCAGGTGGCTGCGGCCTTCTTTGGGTTA
GCACGGGCACCGTCCTTGCTGACGTATCTCCCGAGCACAGAGATCTCAggagcgaggaagaggcaTTTCGTCAAGGTGGCGGACAGTTTGTTGTCCTTCA
TCACTTGGAACACCTTTCGGAGGTGTTGCAGATGCATCTTCATGTCGGCCATGCCGCTGTCACCACGACTATGGAAGAAGATGTTGCCAATGTAGCTCGG
AGCGAAGTCTCGGGACGAGCGCAGGGTGTGCGAGACCATGCGGTTGAAACTGGCAGGGGCGTTCTTCAACCTCTGTGGTATCGCGAGCTATTCCCACCGC
ATCCCACTAGGCGTGCTAACAGCAGTGAGCGGCACGTCATCTTTGCGCAGCATGATTCGATAGAACCCGTCCATCAAGTCGCTCGCACTGTAATTGGTAC
TACCTATATGCTGTCCAACACCATGTACATGCGCGGAATCGACATCTGCGCTGGGATGGTGGCATCGTTGAGCTTATTGTAAGAGTGGAGGATCCGCCAG
CCATCATCACGCAGAATTTTCGGGCTGGCGTGTGGAGACAGGCTCTCACGGATATGGCCAGCCTGTCGTCGGCCCTCGATGATGGGACTACGGAGAAGCG
ACCACTGTCGCGTCACGCAGTACTTCGCGCCGGGTGCGCGGTCGATCTCATGCCGCACTCGACGATCCGGTGGAAGCACAGCTGGGACCTTGTCCGAAAA
AACTGATATGAACTCGTGTA