Description :
From Genome Similarity Track
Location :
Scaffold_1259:4776- 8731
Transcript NameFunction/comments
Phypl_g12925hypothetical protein
Phypl_g12926hypothetical protein

Sequence
3955 bases(100 bases per row)
cgagatgctggaggtTGATTACTCTGGCGTTGTCCTGAGTTTTGGCGGTGCAGCCAAGACCTCCACCAAACAGTGCAGCTGCGGTTTTATACTGTGGCAG
CTACCTGAATGGAGGGTTCTGGGTGCACGAGGAATTATTCTGGACGGAGTCGCGGTGAACGATGCTGAGTATTACGGCATGCTGAAAGGCCTGACCATGG
CTCTCGAACGAGGTATTCAGGACCTGGTGGTTGTTCGTGTCTCAAGGATCGCTATTCAGCAAGTCTAAGGGTTAATCAATTGCAATCAGCCGAATCTACA
ACGTCGACTAGCCGAATGTGAAGTGCTGAAGGACCGTTTCAAAACCGTCAGACTGGTACATGTCCAGCGTGCGTACAACCAGGCCGCGGATTACCTGACT
TCTAAAATGCTAGCGTTGGGGAGTCCAGGATGTAGCTGAAAGGAAACATCTGGAACAAGTGTCGAAGATCCATGAGCAACTGATAACGTCCTCGGTGGTG
ATTCAGGAAGAGAAGAGTGGTGACGAAAATGAGGGAGACTCCGGTACTCTGACTAAGGCTGATCCCGAGCGTTCCATCCTAGATCCAGAAACGGCACGTC
TCTCCCCTGCAGCCCGAGTGATGGCAGTCCTAACCAGGGCCAATGCGAGGGATACTCCTGATGATGGCCCACGGATGGGGCCACTTGAGTTTCAAGCCGA
GCGGTGGCGTCAAATTAAGGTGCATCAGGAACAGgacaaatatttgtcggaGATCAAGGCATTTCTGAATGGTGAAGTGGACGATTTCTCTCCGAGGCGC
CTCACGAAGATCGCCAGGACCGCGGACTTGTTCGTTCTGGATGCCAGGGGCGTCCTCTATCGACTTGTACGCTCCACTCGGGATCGCCCTCGTGATGCGA
CGGATGAGCTCAAGCTAGTTGACCCGAGCTCACTTCGAGATGACATGCTGCATTATGCGCATGAAGATTACCAAGGTGGACACCAAGGTATTGCTCGGAT
CCACGAGAAGCTACGCTCAGAGTTCTACTGGCCGGGCATGTATACAGACGTCGAACGTTTCGCCAAGGAGTGTGTTGACTGCGCTAGTGACAAGGGGTGA
CCCCCTAATCCGGGGCCGTCCCCTGGCAACATCGAGCCGAGACGACCATTCGAGGTGGTCTCTATGAATTTTGTGACGCACATGCCGACGTCAGCCAGAG
GGAACACATTTCTGCTCCTATTTCAGGATGCGTTCTCCGGGTTTGTCGTGTGCAAGTCAATGTCCTCAACGACCGCTCAGGATGTAGCTGAAGCTTACGA
AGAGATTGTGTTCAGGAGGTTTGGAGCATCGTCGATGATACGACACGATCAGGATCCTAGATTCATGAGTGAAGTGTTCACGCGATTCAGGGAGTTGCTG
GGGAGTAAGCAGAGAGCCACTCTGGCATACTGGCCCCAGGCGAATGGCCAGCAAGAACGGTCAGTTCAGACCGTGATGCGAAGTGTCAAGGCGTACGTCG
CGGAAGCAGACCAGACGGACTGGGACGACCAAGCCGAAAGTCTAATGTTCGCCCTGAATATGTCGTTCGATGCCACCCGTTTGGATTCTCCCTTCTATCT
CGTCCACGGGTGGGATGTCCAAGGAACGGTGTCAGCCATGCTAGGACACAACCCCTCCAATCTTCCTGAGCGAACAGCTTACGTCGCAAGTTCCAGCGTG
ATTACAGTTATGCCCAGGCGTGCGCTGAAGAtctgcagaagaaggcgaagcgTGCTCGCTCGGAAGAACAGACCAGAAAATGGCGTGAACGATCGGAACG
ACTCAGGCCAGGATTCGAGAAGGGTGATCCAGTGTGGCTGTTCATCCCGAAGGTACAACCTGGATTGAGCCGGAAGCTGGCACACCTTTGGCATGGACCA
TTCCGGATTGATGAAGTTCGGGATGACTTCCGGGTGAAACTTAAGGTTGAGGACACGGGATACCGTGTGAACCCTGGGTACACGTTAGCAGGCTCAAACC
GAGGGCTACCTTTCCGAAGCGATCCGTCGTTGGTCTGGATCcggacgaagatgacgattTCGACACTGCGTTGTTGCCCGAAGATAGTTGGGAACCGGAC
AATGTCAACAATGAGTACGAAGTGGAGAAGATCCTGGATTTGCGATGGGTCAAACGAACACGGACGTCCAAACGTACCCGAGAATACCTCGTGAAGTGGA
CGGGTTACGATGACCCTGATTGGATCCCGGTATCGCAACTCAGCTGCGGTGCATTGTTGTACGAGTTCAACCAAGGGGTGAGAGCTAAGGAACGTTTTCA
GGCTATGCAGGCCGGAGACGATCATCCTATACAATAGCCCGCCCGAATGGCGGACTCGAAGAATGATGGACTgtggtgtgtgtgtgaaAATGATTGACGA
TGTATTGACCCCGAGTGAAATGTTACCTGGAAGGTTGGGAAGATGACACTCGGGTGGAGTTACCTAAACGATGGCGAGATGGTGTCCAGAGGTGAGAGCG
TGACTGTCGATGTTGGAGTGATGTGAGCGTGAAGGACGAGATGGAAATGCAGAATGTCGAGTGGATTATGGAGTTGTTTAACGCTACGCTGAAAATGCAA
GATGAATGACTTCCTGGATCCTACCTCGACAGGTTGACTCGAGCCACTCACGAGTGCTCCGGGGAGCTCGTCATCCGGGAGGAACTTGTCCCGAAGCGAT
GAAGGAAGGTGAGCAACTCGCTCCCTGTCCGCGGTGCACGAGTTCCATTGCACCCGAGCCGGTTCCTGCTTGTCGACCAGTGCCAACTGCTCCTTCAGGG
AATACGGCCTGCCTTGGCCATTCAAGTACGAGTCGTCCATGAAgatccagaagcagcacttggcAGGAAACGTCTAgacaccagcttcttcaagcaCTGA
TTCAGGCATAGCCCGGTCGACCCACATGTCAAGCAACTTCTTGTATCCCTTCTTGGCGGCATCGCACTCTTTCTTGCGATCCACGTGAAGGTCGTCCGAG
AACGGGTCCATCTTCagagtgatgaagaaccAGTGTCCGATCAACCAGAATGCGCGACGGTGCTCGCTCATGAACTCGACGATATCATCGAGTCCATCCC
GAGCGACTTGAGCTAGTTCGCCGCGCCGGTGAAGGACCAGGAACTTCGAGCGCTCGTCGTACATGACGTCCCAAGGCTCAGCATCCCAAATGACGCGGAA
CCTTGTGGGATTCCAGCGCTTCCGAAGCTCGGTAATCTCGCTTTCCTTGGACACATTCGGGATGTAATCGGGAAATCCAGTTGCCTGCTCCAAAGCATTC
GCCGTTCCAGGTAGAAATTTCACCAAGATGCCATAATGACGCCACGACATGACCCCACGCCCGGGCTTGTCAATCACCCAAAGTTCCTCTTTCGTCTGTT
CGGAGTATTCCTTGCAAGCGAGGGGGGACTTCTTGCGGTACAAGAACGCTTGGGAGGTGGAGAATTTGAACGCACAGGTTTACCTGGCGATCCAGCGTCC
AAAACAGAAGAGACtgagctgcgacgacgcttGGCATCCCGGGGCGGCGTCTGACGACGACTTGGGGTCGTCCTTGTACAACTCGTCacgctcctcgtcg
tccacttcGCCGAACAGAGCCTGGTAGACTTCGGCTTCAGCATCCAGACGGAATTTCTTGAGTGCAGGCCAGGGGGAAGGAGGATCCGCCAAAGTCTCGA
GATACgactcggccttcttgaagtACCAAATTGGAACGTACTTGGCCCAAGGAGTTTGTTCAGCTTGCCCCAATGCATCATTTGAGCAAGCAGGGTCGTG
AGCGTCCGAGTAATGAGCCGATTGTGAACCACATTGTCGCCATTCACGAGATCAAAGGCATTCCGGTAATCCAGGCCTGACAACAGCCTGTTGAAGGTCA
CCACGTTGTTTCTTCCAAACGACGGGAGTGCCTTCCAGAGAGGCCATCACTTGAG