Description :
From Genome Similarity Track
Location :
Scaffold_93:47757- 52947
Sequence
5190 bases(100 bases per row)
CTTCCGTCTGTTTTGTACGCACTATAGGCGATGGGGTCGTTCAAGAAGTGTATAACGACGCTTCGAGATTGTCCGATGCATCGGGCAATGTCTCAATAAC
TCATTTTTGTCTCATGGTAGGCAACAACCTTTCCCATCTCTTCTTACGTCAATATTCTTCCTCTCGGCATGCTTTTGCAGAGAATAAGATCATATATGGT
AGCGTCAGTAAGCAGGCATTGCTATAAAATCAGACGGATCTAAAACAATACCGTGGTAGTGACATATAACGCGGCGTTGCTAAGTGGCTATATCATCATT
TTCCTACCCTTTCCGCTTTTTGGCATTCGTCTATATGTAAGCCTATACTTTTATAATTGAGGTCACAAAGTGACCCTCTCATCCAGAGCTACCATTGGAA
ATAATATTTATCGTATATTCGATTTATTTTTGTTGATTCGTTGAAAAGTGTTGGTGGCTCTATCATTGCTGTCCGCACTGAAAGGTAAAAAGATAGGGGG
CAAGCTCTAAAGCTCGTCTTTTCGGTCCAATGAACAGAATTAATCTTTGCATATTCACGTTCCATATATAGTAGTTAGCGGCTAATAAATGGATGATGTT
TGTGTGCTAAATATTAAAGTGATATAGATCTTTGTGTGTATAAGGTAATTGTGATGTTGTTCATGTTTAAAGTGAGAATGGTAGAAAAGGTAAACAACGA
ATGATCCTGGTCGGTAACGCCTTCAACCACAAAATGCGGTCGACGACATATCATTTAACTACAATAAATAGAAACCAAACGGAAAGGGCTTCCACTGCTA
CTGAGAGAAACAGGTGATTATAATATCTTACTATTTACAAAAAATTTAAGGTCAAAACCACTTCACTTACTAATTGCGAAAGGTACAAGTATTTCGCTGT
CACTGAGTGTCTATAGTTGCGGTGATCTCGGCTGAGTCCCTCCATCCCTTCACTTGACAAGGCTTTAGTGGCACCATGTATTGGGTAGGCCGGCTCATCA
CTCGACAAGTATTTGACGGTGACATCTAATGGGTTGACCGTCTTGTTACATGACAAGGCTTGACAGTACCATCTATTGGGATGACCGGCTTGTAACATTA
CAAGGATTTAGCAGTACCTTCTATAGGGTTGAACGGCTCGTTGCTGAAAGGGACTCTTTTTTTCGCTAAAAAGTAAGTAACGCTTACCCGGGCCAACTTG
AGCGCTTCAGTTTGGAAACTTGACATATATGCCTCTCTATGTTCGACGGTAGGCATCATATCATCCGCGCAGGGACTCATCGGAAGATTGCATACTCGGT
CTAGACTTGGTAATTTCTTCACTGTATTGGCTTATTGCTTTTGCGATTTCGTGGAGCTGTTTTGTGTGGCTTTCTGTAGGCGGGCGATTAAAGCTGCCAT
GCGCTACCTTAACACACATCTTCAGGCACCTGCAAGGAAGCAGTTTTACCGTCTTCTCTCACGTGCAGCGAGGTTCGGTTGGGCGTCTTACGACTGCCTC
GCCGAATATGAACGCTTGTTGTAGGTGTGGATCGGACGCGGTTTCCCGTCCTCCGGCACACACGTTACAATTAGGTTGCAAACGAAAGACTAAATTCTAT
TTAATTAATTAAACAGAATCTAAATTATTATTATCTAAAAGACAAAAGATTAGACGCGCGCTCTGATGAGACGCCGTCTCTACAGCACGCTTGAACTGAA
TATAAGCGCGCTGATGACTTACTTCAATGACATCGTGTAATGAATTCAAATAGTGACGTCATCCATGTGTGTGACACACACTCTGTGGTAGGTACGCAAT
TGCTGTACCCCCACATGAAAGGTCTAGTGCGTACCGCAATTAAATCTTCTCAGACTTTTCTGTACCTTTACACGAAGATTCTCGTGCAACGGTTTGAACC
CGTTACACCACCCCCTTTTCAAAACGGTTGTTAGCATCGTGAACATCGCAACGAAGGAGAAGCACTTGAGAGTGAGTCGTCAAAGACGTGCCGTTCGCTA
TCTGTGCTTGCTCTTCTGAACTGCATGTGAGTGCGCTCTTTCTCTGAGCAACACCGCACGGCGTTCTAATGACGTCTAAACGTGGGAAGGACGATGAGTC
GCCTGCAAAAGGTGCTTACATCTTCTACCACTAAGCGCGTGTGCGTCGCGATACAACGACGACGACACAAGATGCTAGTGTCACGACGACGACTGCTAGT
ACAGCGGTCGCGTCATCGACAGGTCCTGGTGGTTCACCTCACGCATCTAATGCGGAGGATGACTCTGCATTAATGGTAGACTAAAATGGGTCTACTCCCT
TGCCTTCACCAATGGATGATGAAGACAGGGAGCGTAAGTAGAACGGGGATGGATCGGAGATTCTCGTGCAACGGTTCGACCCGTTATACTTTCCGTCTTC
CTACCATTTTACTATACATGTACCTGATGAAACGTATTTTGGATATTCTTCCAGCCTTAGATAGTTACACGCTTTCATCAACCTCGGATTTCGTTGAGTT
CGCCGATAAGATTTGCTGACCCAGTCTTGCGCTGAATTGAACCCATAGTAACTTTCTGATGATAATTTCCAACACCACACATACATCGCGGAGTCTCAAA
GAGCGGAGTCCCATAGCATGAATTTTCACTGTCGAGTCCCGTAGTTCGGGTACCATAGCGCATAGTATTTCAATGCGGAGTACCGCAGAGAACTTCAACG
TATAAATTTAGTACATCACACTTGTTGCTTTGAGTTCCTAGTGCTGTGAATCACCTCGAAATGTTATAAATTCTCAAGCTGCAGTATACCCTAATTCCCC
TAGAACAGGTATCTGCTTACGTCGTTTTATTTTAGTTCTACATAATTAAGTGTTTTCAGTCGAACGTTTTCCTCTGGAAAAAATGTTTAGATCCGCTACA
CCTAAAATGCATAACCTTGAAGATTCTGTCTAATGCACCGACCGAATATCGACAACTAATCATGATAATGTTGTACTTACTTGAATGTGTGCCATGGCGT
TCTCGTGAATGACAAGTAAAGTAGAGGTTTTATTTAACGGTGGAGATGATGTCACTACGGAGGCAGATGTTACATGCAACTGGTTAATTACAGAATCGGT
GTAGAATTGAACGTGAATTGTAGCGAGCCTAGAGTACGTAGAGATCATGTAGTATGTGGATAGATATTCAATTTTTTGTAGGGAATAGAAGAGATTGCGT
CGCCCAAGACGAGGCAATCAATAATGTAAAGTCTGTTTGTCACCTTGCATGATGTGATGACATGTTGTTCTGAGCTGCCTAAATCGCTTATACGCCCGCG
AATCTCATTGTGACAGCGATACGAGTACAAATACAAAGGATCTGCAATCTGAGGTAAGGGTGACGGTGAACGCAAGCGAACTTTACCTTGACCAAAATTA
TGCTCATAGTCGACCGTTTATGCGCCTCGAGTCTTACTTATTGGTACATGGACGATTCATAGATAAGATAGGGCAGCAAAACTCTGGAGCTCACCCCTTT
ATATCGGTTATTCAGTCCAAGGAACTAAATCAAGCTCGTTATATCTGCATTCCATATCGGGCGATAAGGGGCTGAAGAATCGGTTAGCGGCTAAAGAATC
GGCTGTGCGTCGTTTACTAAGATGAAAGTGCAGTATATCGGTATGTGCTTATGGTACTCGTTGATCTTGGATGTTTAAATTACGAATATCGGGAAACGGA
GACGGGGTATGATGCTGCTCAGTAACGCCTTCAACCACATATGTGGCTGACGACACTAATTGATTGACGTAGAAGAGAATTTAAATTGAGGAAACTTTCT
CTGCCACCGAAAGAGAAATGTGACTACAAATCCTACTATATTAATTTATTAAGTACTACGTATGAAAATCACTTCATAGCTGGTTAGCCCTTTGATCGCC
CGTGGTCACTTTGGATCCAATCATGTGCTGGCGTTAGTGCAATCATGTGCTGGCGTTAGTGCGTGTGTGGAACTTATACAACGCCTCGGTTAAAAAATGA
GCTAATCAAAGAGTGCTCTCCTAAACTGCGTACCTACCAATGAGGAGGAGACATGAAGCATCGTGATGGTACTACTTAAAAGGCACACCTAGCATTATTT
ACAGACACACATATAGACAAAAAGTATCTTTAAGTTTGGTATTTACTCTGCACCCAGTCATTAATCGCGTCATCTTTCGAGCTGGCAACTATATCGATGG
TAGATGAAGCTAAAAATATATAGCACGAACAGAATGATTTTTTTCGATGCAGATTTTCGGGTACGCAAGCAAAGATGAGGCGAAGGTGTGTCCGGTGAAG
TAAGACGGCCCGACGAGTTAGGCACTTGTATATTGAAACGCATAGTTTTCTCTAATCTATTGGATGTTGTTCCGTATTCAGGCGCACTGGAACTAGTCGA
GAAAAATGCATACTTTGGAAAGCTTTGACGCCTTTATCTGCTATCTACGTATCATGTGCAGTGTTTGTAATGATCGTACCATATACTACTTATCTGTGAA
TAGCTATTGTAACGGGTCCAGTCGGTACTAACACTAGTGGCGAAGAATGGGACCCGATTCTGGAAATATTATGTACACAGCCAATTATGAAACTACGCAA
GTAAGTTACAGCAAGTTCACTTATAGTCTCAGTGAAGCTACATCGACCGTTTCGTTCTCGATACGACTAACACTACACTGAAGTCCATGGTATCGCTTTA
CGCATGACATATGTTGACAAACGGCATTGAAAGTGTAGGGGATACGTTGAAGATGACTGCTCACATAGACGGATGACCTGCAAAGGAGGTAGCGCGACAA
AGCGCAGAAGTTGGTAAACAAGGAGCTTAACAGGCAGTCCTCGTTATTTCCCTTAGTTTCAGCAAGTTGTTTTTGTGTGTATGTAGGTTAGTGCGGTATC
GATTAATATACATAATCAGCTGAAACTTATAAAAAACGGCGCTCATCATCAGTAATCGGCATTGCTGTCCAAAACGCGTCACACAGGTGTACCCTTCAAT
ACATCAAGCTGACGATACACATCAATCTCAACGTAGCTCTTCACAAAAAGCTACGCATAAAAACAGAGAAAGAGTAAACCAAAACGAAAGGCATTACCTC
TTACTTGCACTTATAAATCTGGAACTAAACGCAAGCATGTGCGAACCGAATAGAAATGGGGTGAACAGCTCAACCCCAACATCCATGATC