Description :
From Genome Similarity Track
Location :
Scaffold_632:4775- 7654
Sequence
2879 bases(100 bases per row)
TGTACGATCGCCTCATCTAACCGGTTCTGTGCCGGATCGCCCTTCCCTGCTTTTGCAATCATACTGACCGCAGCAGGCATTTCTAACAATAGCTGTTCTT
CATTTCAAGGGCGGTCTACATTCTCGATATTAACTCGTTTATCGTGATTTGTAATATCTGACACCCCTGGTTGTGACAAGACCTTCCCCGATCGGCTTAC
CCCCGTTTCTTTTTCTTGTTTCTCTCTATGCCTCAGAATCTTCTTGGGATGGTGTACGACGGGTGGTCCAATAGAGGCCCCGAATACTCGATCGGACGTT
CTTTGATTAACTTCGTTGTGGCTTCGAATGCCATAGTCGGCGATTCATTATACCGGCGTGATCCCACCTAAACATAACCCGGTGATCGAGGTATTATGTC
CATCATCATCCGCCACGCTAGATGTGTATCGTGATTGAGAATTACCTCCTGATCGACGATATTGGTTAGTATCAAATACTTGATCTGTCCGGGGCCAGTA
GTAACCGTCGGTACCCACTTCTTGTACCGCCTTACCCATAGTTTGGATTTAGGGAAACCTGCTCCAATCTTCATTTCTGTGGATCCTCCGACTGGGATTA
CCACATGTTGATATGGGGTTTATATTTACTCCATATGGAGGTCGTCGCCCTGCCAGGTGAATTTTCACTTCGTCTGGCAAACAAAGCGTTTCATCCGCTA
GGTCCAGACGTATCCCTGCTGGCAACATAAAATCCATACCTAAGATTGCTTCTTGGCCAACTTGATCGCCCACCCAAACGTCAAAATAATATACCAGTGA
TCCGTTTAGTGTGATCTTGATCTTGGTGCATACTTCAGTCATGTAGACGATCTCCCCGATTCCCACACATTCTCGCTTCTGGCTGTCGTCGATCATACAC
CTCACCTTACAAGCAAAGGTAACGTCGATGATTGAGACTTCGGCTCCAGAATCGAATAGCATAGTGGCTCTTTCGTTGTTGTTTCTTGCCCACCGCTTTA
GCTTGTTCAAACCACTTTCCAGATACTTCCAATACCCTCTCGACTCACTCGGCGCTAGATCGAGCTCCATGTTAAGAAGAGATCGCGAATGTTCATCCAC
CTTCTTCACACTTGAAATATTACGCAAACGATGGTTATCCAAATAACATGTATTAGCGATCGGGCCGATCCGATTGTTGCTCCCTGATCGATCCTTTCCG
TATCCACAAATGCATATATGCATAGCCTAGAACGCTCGGCTCGTGCCAGATTCCAACCTGGCGAGCGTCATAGTTTAACATCTTCTCCTCCTTGGTCTTG
ATTAGCCCCGCGTGCTTGGTCGGCACGTACCACATACGAATAATGTTGTAGAACTCCTCCATGCGGCATTGACCGCTCTCATGAACCTCCCCACAGGCGG
GACACACATGTAGGCATTTTTCCGAGGGATGTACTTTGCGGCCACACTTTTGACAGGTCAATCGTTTCCAACATATGCGATCATCATGACTTTTCGAGCC
ACAGTGTGTGCAGGCTTTCGAAAGTCCGAAGAGATCGCGATCGTCGTCCCGATCTGTCTTCCGCGATCTGTCTTTAGCGATCTGTCTCGTTGCTCTCCCG
GATCTGCGACCTGATCGAAGACGGTCGTTACACAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAAACATTTTTCATCATCGGTAG
ATAATCGCATAGGAAGGCAGTATTCATCTCGTTAAACCAACTTCTGGCACGTTCTTCGTCTTGGTCCCGCCCTGCAAATTCTTTCAGGTCCATCATCGCC
GACAATTTTATCCTCTGCGCGCTGAAACCTCCAGTAGGTGCGGTTCCTGCGGTTGCCACCTGCGGTCGCCTTAAGTCGCCGAATCAGTTACGGTCTTGAT
CATATTCGCCCGATCGATCACGGTACGATTCAACTGATTCCATTTCGACATTTTAGATATATCGCTCTTGGGAACTCGTTGTCCTTTCTTGGACGACCTG
GTGACTTCCTCCTTGTCCTTCGCGATCGCGATTGAACTTGTCCATAGCAGCCTTGAAATACGAATTAGCTTCTCGAATA