Description :
From Genome Similarity Track
Location :
Scaffold_539:4775- 6983
Transcript NameFunction/comments
Phyke_g10130hypothetical protein

Sequence
2208 bases(100 bases per row)
GGTCCCGCGCTTGCCCGTGTGTGAGCTGCGTCGCCAAGCTTCTCGTTCCACTTCGACCACCACTTTGACGTTGGCAAGCCGATCTTCCATGTGTGCGACA
TCATTCTCAAGCTCCTGCGCTGTAGCGGACATAGTCAGCAATATGTAGCTACTACTGAGGAGATCACTGCACCTGGACACCTTAAAGACAAGCGAGCATG
CCCTGGAAACTGTGTCATGAAGCGGAAGCTCTATTTATACGGACCGCAACATGAGTCATAGCTCAAAGATAGATAGTCACGATGTCTGCAAAGTTCACAC
GTCGTGCTGCCGCGACAGACTTGCTCACTTACTTTTGCGAGAACGGCAAACGCATCGCTTGATATAGGAACGCAATCTCCATGGCACTCTCCTCTAATTG
CTCGAGACGACCTCCACCGCCAAAATGGCCGTCATCTTCACTCAttttcaacaacatcaaTCGTTTGTCTTTCTTGGGAAGCGAGGCTTGAACTTGCCGG
ATCTTGTACATCCACTTGGCAGGTTCCCAAAACTGCACGCGCTGATCGTTCAAGCTGCCGGTCACGAACATGGCAGGATAGACCTGATTCTCCTGCACGT
TCTCACACGGAGCGTAGGACTGGATGTACTCGTGCGCCTTGGGTCCAGTGGGATCACCCCATTCGTCATACTCATGGACAGTTAATGGCAACGTGGGGTC
CTGCATAGTAGCCAGGATGTCTACGAAGGGCACCTTCATAATCAACGCTTGGTAAAGTTGCGGGTACTCGTTTGCCATATACCCCATGATAAGCCCGCCG
GCGCTCACTCCTTTTCCTGCGAGACGCTTCGGGTTCGTGTAGCCTGCGTCCAGCAGGTGGTGCGTACATGATACATAGTCATCAAACGTATGACGCTTCT
GCATGCCTTTGCCAGCCTGATACCACTGCAAACCTAGCTCCCCGCCACCACGCACGTGGGCGAGCGCAATCACCCAGCCACGCTCCAACAAGCTCAGATA
TTCTAGCTCAAAATCGGCTTCCAGGTTAATCCCATAAGCACCATACCCGATAAGCAGCGTCGGGTTTTGCCCATTGAGTGTAATGCCACGGCGGTGGATG
AGGGTCAACGGAATTCTTACCCCGAGACTGCTCATACTAGGCACATAGCACCGTTGGCAGGTATACAAGTCAGGCTCAAAGGACGACTTCATGAGCTTGC
CGGCACTGTTGTACCTTTCCTTCATCGAATGGTCCGTAATTTCTGTTTCTTTCAGGAGACGGAGCTCCTTGTGCATCATATCATAATCGTACACATTTTC
CGGAACCAGTGGAGTGGAAATCTGGAATCGTACATGGTGCGAGTCATAGTCGCGATTTATGCCAGGTAAAACACGGCAGACTTCATGCTCCTCGGGAAGA
GGAATATAGTGTAATTCACTAGCGTCATCCGCATTTTGCTCGTCCAGTTTGCACACCCGAATACGGGGCACACTGTTCACACGCTCGTACAGCACCAGAT
ACTCCTTAAACAGATCCACATCCTCGATCTTCACATCCTCGTGCTCTGGAACAAGTGTCTCCCATTGACCAATAGAGGGTGACGTTGCCTTCGTTTTCGC
AGTGGCGATCTTATAGTTGAAAGCACCGTCGGCATTGGTTACGATAAAAAACTGATCCGCAGCATGGTCGGCGAAGTACAGCGTGCCAGCCTCGCGTGGA
CGCAACAATTGGGgcttggcagcaacatcgtGTCCGTCCAACGCGTGTATCTCGGACGTGCTCTTGGAGTTGCAGTTGATCAGCACAAAGCGCGTGTCCT
TCGTCTGCGAGACATCCACAAAGAACGCTTCATCGTTCTCTTCATAAATCTATGGACAGCCACCACGTCACAACCGTCAACACTGTGAGTGATATTCGCA
ACAGACAGCCGACGTACCAGTTCCTTCACGTGCGTGGCCAGGTTATACCTGTACACAGCAAAGGGCCGTCCATTGTCGTCGACCTTGGTGAAGTAAAATA
CTCGATGTGGAGTCGGCGCCGAGCTCCACTCCACATTTTTGATGGCTGTTACATCTGGCAAAGGCTGCAGCTGGCCAGATTCCAAGTCCCTCAGTACGGC
ACGACACTGTTCGTGGTCGTTCTCCATAACTAGCAGCACTTGTTTTGCGTTTGGCGACATTTTCATGCCTGCCACAAACTGGAAACCGTGTTTGAGCGAG
GGCTCCTT