Description :
From Genome Similarity Track
Location :
Scaffold_68:47730- 49577
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_11160predicted protein

Sequence
1847 bases(100 bases per row)
CTGCACGCGCTGGGATCACGGATGACAGACCGTGCTCTATCTAATTGGCTGCAAGTGGCGATGGCGACCGCAGTCGCAAGCCAGTAGCTTGGGTGGTGTT
GCAGTTGCGGCGGCCTCGTTGAAGTTGCGAAAGCGATCTTATATTGTGCACTTCCTCGTATCCGCCGCATCCGGACGGACGCCAAATTTCCTGTCATTCC
CACGGCCAAGTCAACACCAAAGAAGATATGCATCGCTCCTGAGAACACGAGCGTTCCAACACCAACGAGTACCTTCTACCAAGGACATTTCTGGCCGTCG
TCACCCATTTGACAACGAGCGCATGGCCAACAAGTACCTGGCAGAAGGAGAGAGGACAACAATCCATCGCAGGTTTTGCGAGTACACAAGTAGCGGTGAT
GCATATATCACGCTTCCAGATTCACAATCTGCGCCATCGATGGGACCCAACATATCTTTCACGCAGCATCTGGTCGTTTCGAAATCGACGAGCGTGATGG
CGGCCTTGGACTTGTTGCACAAGCAGACGAATGAAGTGCCCCATGTTGTGCGTGATCGAGTGGCCTCGCCTTCTAAAGCACACCAAGCAGTCCGCAACCA
GTTGACCAAGACAGCGGGAAGGATCTTAATATCGCTGTGGATGAGGCAGATCGGACTAGTCAAGCAGACGCGGTTGCCCTTCGTATGCAAGAAGATCGTC
GTGCCTTGGCCTCGGTTTGAGTTTGAGCGCGCTGGCCCACTTGTCTAGCGCTGGCTTGAGGATTTCGAACGGCAGCGTGTTCAGGCCTGTCGATTTCAGC
GCATCTGCATGCAGTTGTAGAACTTCAAGACCGGTACCTCGAGGCGCGCAGCCATGTCCGGCATGAGTCGCATCTTGATTGTCGAGTGGAGAACCTGGGC
GACCTCGCGTGCCTTCCCCTTCAACAGCGTGCAGCGACATGCCAAAACCTCTTAAAGAGAGATGTAGACCGGACCATCAGCGTCACGGATCTGGTAGATC
GATCGAGTTCCAGCTTCTAGATCGGCCATGACTGCACGTGGTCCGTGGTGCATCGAATGACTTGGACAAGATACCTTTGTCAACACCAACATAGACGTTA
CTGGTCACACAAGAACCTTGCCGCATGGCGACGGCCTTTCTAGGCAAAACGCCAGTTGATTGGTCTATTGGTTCAAAAACCAAGTTATAAAATCCATTTA
TGGTTATGCAAACTAGCAAAACATGCAAAAAACGGTACTTTCCAGCCGTGCGGTAGACATTGTCTTACCATGTGACCGTGGGGACAGACGCGGCTCTCGC
GCCAACCTTGCTTGAACGCATCCCCGTCGCCGACTTGAGGTAGCAGACGCCTTCAAACAAGACATACGCGTTGCACTGACTGTTCTTCAAGCACGTATCG
CAGCACTGGCCGATCATTGCGTTTACATCGCCTGTCGCCTTGAAGTTGGCAATGTCGTTGCCAAAGTAGTCGTAGTCAACTTCGGGGTTGCTGCAGTAGC
GGACGCTGGTACCCGGCAGAGGCGGCACGATCGCGGACGTCGCGCCGTTGACTGGCCGCGAGTTGATTGCGACGGTCTTGAGGTAGCAGACGTTGTTGGC
GAGCGTGTACGCGCTGCACGTGGCGATGGCCTTGCAACCGTCGCAGCACTGCTTGAGCATGGTGCCAAAGTCGCCGGTCGTACCGAAGTTGGAGATGTCG
TTGCCGTAGTAGTCGGTGTTCCAGACCGGTGCGCCGCAGGTGCGGTTGCCCGCCGGCGTCGGAGTAGGCGTCGGTGTCGTCGTCACATATGTCGTCTTGG
CCGAGACCACGCCTGGCTTCGCCTTGCGCCCAGCGTCCGACGACTTG