Description :
From Genome Similarity Track
Location :
Scaffold_632:4773- 7654
Sequence
2881 bases(100 bases per row)
CTTGTACGATCGCCTCATCTAACCGGTTCTGTGCCGGATCGCCCTTCCCTGCTTTTGCAATCATACTGACCGCAGCAGGCATTTCTAACAATAGCTGTTC
TTCATTTCAAGGGCGGTCTACATTCTCGATATTAACTCGTTTATCGTGATTTGTAATATCTGACACCCCTGGTTGTGACAAGACCTTCCCCGATCGGCTT
ACCCCCGTTTCTTTTTCTTGTTTCTCTCTATGCCTCAGAATCTTCTTGGGATGGTGTACGACGGGTGGTCCAATAGAGGCCCCGAATACTCGATCGGACG
TTCTTTGATTAACTTCGTTGTGGCTTCGAATGCCATAGTCGGCGATTCATTATACCGGCGTGATCCCACCTAAACATAACCCGGTGATCGAGGTATTATG
TCCATCATCATCCGCCACGCTAGATGTGTATCGTGATTGAGAATTACCTCCTGATCGACGATATTGGTTAGTATCAAATACTTGATCTGTCCGGGGCCAG
TAGTAACCGTCGGTACCCACTTCTTGTACCGCCTTACCCATAGTTTGGATTTAGGGAAACCTGCTCCAATCTTCATTTCTGTGGATCCTCCGACTGGGAT
TACCACATGTTGATATGGGGTTTATATTTACTCCATATGGAGGTCGTCGCCCTGCCAGGTGAATTTTCACTTCGTCTGGCAAACAAAGCGTTTCATCCGC
TAGGTCCAGACGTATCCCTGCTGGCAACATAAAATCCATACCTAAGATTGCTTCTTGGCCAACTTGATCGCCCACCCAAACGTCAAAATAATATACCAGT
GATCCGTTTAGTGTGATCTTGATCTTGGTGCATACTTCAGTCATGTAGACGATCTCCCCGATTCCCACACATTCTCGCTTCTGGCTGTCGTCGATCATAC
ACCTCACCTTACAAGCAAAGGTAACGTCGATGATTGAGACTTCGGCTCCAGAATCGAATAGCATAGTGGCTCTTTCGTTGTTGTTTCTTGCCCACCGCTT
TAGCTTGTTCAAACCACTTTCCAGATACTTCCAATACCCTCTCGACTCACTCGGCGCTAGATCGAGCTCCATGTTAAGAAGAGATCGCGAATGTTCATCC
ACCTTCTTCACACTTGAAATATTACGCAAACGATGGTTATCCAAATAACATGTATTAGCGATCGGGCCGATCCGATTGTTGCTCCCTGATCGATCCTTTC
CGTATCCACAAATGCATATATGCATAGCCTAGAACGCTCGGCTCGTGCCAGATTCCAACCTGGCGAGCGTCATAGTTTAACATCTTCTCCTCCTTGGTCT
TGATTAGCCCCGCGTGCTTGGTCGGCACGTACCACATACGAATAATGTTGTAGAACTCCTCCATGCGGCATTGACCGCTCTCATGAACCTCCCCACAGGC
GGGACACACATGTAGGCATTTTTCCGAGGGATGTACTTTGCGGCCACACTTTTGACAGGTCAATCGTTTCCAACATATGCGATCATCATGACTTTTCGAG
CCACAGTGTGTGCAGGCTTTCGAAAGTCCGAAGAGATCGCGATCGTCGTCCCGATCTGTCTTCCGCGATCTGTCTTTAGCGATCTGTCTCGTTGCTCTCC
CGGATCTGCGACCTGATCGAAGACGGTCGTTACACAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAAACATTTTTCATCATCGGT
AGATAATCGCATAGGAAGGCAGTATTCATCTCGTTAAACCAACTTCTGGCACGTTCTTCGTCTTGGTCCCGCCCTGCAAATTCTTTCAGGTCCATCATCG
CCGACAATTTTATCCTCTGCGCGCTGAAACCTCCAGTAGGTGCGGTTCCTGCGGTTGCCACCTGCGGTCGCCTTAAGTCGCCGAATCAGTTACGGTCTTG
ATCATATTCGCCCGATCGATCACGGTACGATTCAACTGATTCCATTTCGACATTTTAGATATATCGCTCTTGGGAACTCGTTGTCCTTTCTTGGACGACC
TGGTGACTTCCTCCTTGTCCTTCGCGATCGCGATTGAACTTGTCCATAGCAGCCTTGAAATACGAATTAGCTTCTCGAATA