Description :
From Genome Similarity Track
Location :
Scaffold_437:477237- 478879
Transcript NameFunction/comments
Aphin_H310_05791PREDICTED: nitrogen permease regulator 3-like protein-like

Sequence
1642 bases(100 bases per row)
ACTCATGGTCGGCGAGCGCTAGGATGTCTGCGTACGTACTGAGGACTGTGCGTAGCTCGCCCCGTGTGACGTTCTCGCGCCACATGATTTCCACGAGGTG
GTGCTGGCCGTGGAAGTAAGGTTCAAGGCGCCGAAACAACTCAACGACCGGCGTGGGTGTGTTGGCTTGTCGCGTGAGTTGCGCGAGGATCTCCTTGTCA
GTCTTTTCGGAAGACTGGGGTGAGTAGGACGATAAGAGGGCGGGGGAGTGCGAAACCGGCGGCGGCAACCCATCATGTACACCGCTTCCTTCAGCGTCAG
GTATCAGTAAATGCACATATTGGTGCATCTGCGACACAAACTCGTGCTGGAGCAGCCAGATCTACAGCAAGCATCATGTCAACGCGCCTCCATCTCGTCA
ATCGCAATCCCGCACCAGCATGTGAATGTACTCGAGTTTGCGCTGGGGATTCAACGTGTTCATAAAGACCGATAGCCGACTCTTTCCATTGAACGTCGCG
AGCACTTCGGGCAGCTCCATGGAGGTAAACTTGCGACGGAACTCGAGTGCGGTCGCCGACTGGCTGTGCACGTTGGTCGCAGTCGGGTTCACGTGGTACA
CGTTGTACATGGTGACGGCCTCGATCACCTTGGCGACGCCCCAGTAAACCAAGTGCGCCGCAAGCCGGAAAAGTTGTTTCAAAGGAAGGCCCGTTTCAAG
CATGAGTTCCTGGAAGTCGCGGAGGGGGTTATGCGCGCTGATGAGGAGGCGGAGTTGAGGCGACGCATCGGCTGGGAGCGCCTCGAGGACCTTGTCGTTG
TCATGGAGGAGCAGCAGGGTGTGGTACGGCCGCATGGACGTGATGTGGACGGTGGTCGCGTCGTCCAGTGTTAGCGAGAGCTGCACCCACCGATTCAAAA
GCACGTGGACGGCGCCGTCTTCTTCGAGTCCGTGGTAAATGGCCTTGAGGTCATTGGCGAGAATGCTCTTGCCGAGGGCGACGTCAATGAGTGTTTGAGG
GTCGACCTCGACATCAGTTGTGTCCTTATCTCCGCTATTGCCCCCGTTGTTCCCGCCACCGCCGCCTCCGTTCGGATTGTTGTCGGACGAATGTAGCGCA
AGTTGCCGTTCGTTTTGAGCGATTTCGTCGCGAATGTGCAGCAACTCACGCACTTCGGTGGTGACGAACCCCACGCGCGCTTCCTCGTGCATGAGCGCGT
GGGCGAGTTGGGACGCGACTTGGGCAAATGCGTTGACTTTTTTGTCCCGTTGCGAGGACGACGGAGGTGATTGTGAAGATGACGCTAGCATTCCGTCGAG
CTTGGCATCGTCGAGGGCAAAGATGACGTTAAACATGGACGTATCGCGCCGTCCAGACGACGACGCAGTTCCTGTGCAGGTCGCATTTGTCGACGACGGC
GCTGGGTTTGCATTCGACGTCGGCTCGTTGATCGTTACAGGGTGACTGATGAATCGGAGGTCGTCGATCACAAGTTGAAACGTTTGGTTGCACAGGACGT
TCTTCGGGCGGAAGAGCTTGGCGACAAGTGCGGAACTCAAGCGGTGAAAGGCAGACACGTGACTGTCGCTTTGAGGGGCGGGGTACCGGAAGGCTAGGTT
ACATCCCTTGTGAATGTCATCGACGACGAGTGCCACCCCGAG