Description :
From Genome Similarity Track
Location :
Scaffold_30:477223- 505438
Transcript NameFunction/comments
Physo_134225PREDICTED: similar to ATPase, H+ transporting, V0 subunit B
Physo_134226hypothetical protein
Physo_134227hypothetical protein
Physo_134228hypothetical protein
Physo_134229hypothetical protein
Physo_108767Uncharacterized protein involved in cation transport
Physo_134231hypothetical protein
Physo_134232hypothetical protein
Physo_108768GTP-binding protein TypA
Physo_134234putative glucan synthase

Sequence
28215 bases(100 bases per row)
AGCCAGATCTCCACACACCACATTTTTTATCTGAGCATTTCTAGTCCATCTAGTGAAAAGTAAACTATGCCTGCGGTTCGCTGCTATCCTGGGTGGTGGT
GTCCGCAGAGTCCATTGCTTCGTCCGCTTCCGCCCACACTGCCAAGAGACACTCCTCGTCAGATTCCCCACTACAATAGTTCATCATGCCTCATTTAGCA
ACGCACCTGGCTTGTTTGAGCCGAGTTTCGGTCGGTCCGGCTTCGCGATGGAGACGCGCAGCGTCTTCCCGAAAAGCTCCGACTCTAGTGATCGAACACA
GCACACACAACACCTGCACCTTTAGCCGAAACACCGGTATATACCTGCTGCATTCATACGCACCATCCATATTGTCAATTGCTGCTCTGGCGTCGGCCTC
ATCCTCGAACTCCACGAAGCCGAAGCCTTTGCTCCTTTCTGCTCCATCACCAGCAACGACGAATGCAGTACAGTGAATAGTTAGTGTCCGCCAACCAATT
GACCGCCGAGTACTTCGTCGACCGACGTACGCGTGGAGTAGTCCATGGGGATCTGCACGCCCTTGATGGGCCCGAATGGCACGAAGGCCGTGTACAGACC
CTGTTCCGTCACCTGCTTGTCCAGCCCGCCCACGTACAGCGCGCGCTTGTCCGCCTTGCCCGCCATGGTCAGTGCCTTGTGAGCTTGGAGGTGTGCGAAC
TTAACTGTCCTACTAAGTTCGTTCTGATCTTTTGAACCGAAACGGCCCACACAGATTTATAGAAGGGGGCGGAGCTAAAGCGGCAGTGATCACCACCTCG
TTCGGAGCAGGATATCGCCATGAGCACGGCCACGGACGAGCTGTTTAACCAAGGTATGTGAGAGAAGAGAGTGCTGGCGTCATGTACATGCGACTACGGA
CGCGTAACTCGCTGTCGTCGCGGAGAAAAATGAGGTCAATAGAGGAAGCTGATTATGCATAATACTGTGCTGTTGATATTGCTAGGTTGGGGCGACGTGC
TGAGCAACATCTCGCCGTATGCGTGGGGCAGCATGGGCGTGGCCTTCGGCTTGACACTGTCCATTGTCGGCGCCGCCTGGTGCGTCTCGAGCTTCGTCTG
GCTGCTGGAATAATAGTAGAAGCGCTGACAGTTTGTTGCCTTGGATTACTCGCTACAGGGGCATCTTTATCACGGGCTCGAGTCTGTTAGGCGCCGCAGT
GAAGGCCCCGCGCGTGCGATCAAAAAACCTCGTGAGCATCATTTTCTGCGAAGCCACTGCAATCTACGGCGTCATCATTGCTATCATTCTGCAGAGCAAG
GTGCGACCTGCAGTCAAGCGAGAGAGTTTTGCTGCAACAAACGTAGATTGACTACGACAGTTTCGCAAGTACTGATCGCCTGTGTGTAAATGCTGAACAG
ATGAACCAGCCGGGTCTGCGCAATGAGGGAGACGAACCGATCAACGAGCAAGCGCTGTACTTTGCAGGATACGCTGTCTTCGGCTCGGGTGTTGCAGTGG
GCTTGACGAATCTAGCGAGCGGGTACGAGTCGCCTGTTGCTTGTGTGTGAATGCGCTAATAATCAAACTCACGTGTGGCTGTTGTGCTTTATCAGCGTGT
CCGTCGGCATTGCTGGTAGCAGCTGCGTGCTCGCCGATGCGCAGAACGCGGCGCTGTATGTGACGATCTTGATTGTGGAGATTTTCGCAAGCGCACTGGG
CATCTTCGGTGTCATCGTCGGCATCATTCTGTCCAACAATGCAGAATTCCCTAAGTAAGCGCAAATTGAAGCCGACCAGACGTCAGCGTTAACGCGCAAG
ACCAACCACGCAAGATTTGCCTCGGGCTAGTCCCAGTAGGTGGAGGTGCATGTTGTGGTGGCTCACCAGCTCGAATTCACTTCACCATTTAAGCAGATCA
ATGCATTTCTTTCCTCTATCGAAATGGAACGCAGCGATGCTTGCAAAATCTTCGAGCGGATGCCGATCATTTCCACATTGCGCGGTCACTTTCGACGTCG
ACAGGTGTGTACCATTCAGGCAGTTGGTGGTCCGGGTTGTATCTGGTTCAGTCACGCCCAGGTTTAGCAGCAGAACTGCTTTAATTTAGGGGGGCAAGCA
CTTACCGGTAGTTGAGGAACAGCTCTTCCTCGTCTGCAATGTCCGCCGTTGCGATGAAGGCCAGACTCTGTTTCAATTTTTCACCAGCAAAGACTGTAAG
TACCAGACCGATCAACTTCAGCCCTTTATGGAAGCGTACATGCACGATAGCTCGTTTGCCAAACATGGAGAGGCGTGAAGGCTCCTTCACAAAGCTATTC
GGAATGAGCTCATCGAATTCCTTCGTGGTGAATGGCTCTGCACACGAGTTAGGAGATAGTAAGTACACGGGTAGTAGTTTGGGTAGTAAAAACTGACGTA
ATGACAAACCTTCCGGGGGAAATTCGAAGGCGAATCCAAGGACGTTAGGAGGGGTTCCGTTGGGAGGATGGTTGATCTTGTGTGCCACAGCGAGCGGGTT
GCGAGGCTTCGAGGCTGGTCTCACAAAACAAGTCAGCTCAGTGCATAGTAAAGGATGCATCTCAAACTCTTACACTCATTCTTGGCGTCAATGATCACAC
TGTCGAATCGGGCTCGAGCGTACGGGTTATTCGAAAGCTCGCTAAGGTAGTGTTTCTATCAGTAATAACGAGACTGAGGTTAGCATACATTAAACCATTG
CATTGACAAAATAATACCGAAGATTACATACCTTCTTGTAGTGCTCTGGCAGGTAGACGATGCCAGGGTACAGAGCCTGATCGGGTTGTCATGTTCACCA
GGTAAGAAGCAAATCACAAACCACAACCGCCATTTTTCTATCGTACCACCAGCGACCCAATCGGAGCGGAACCACGAAGCTTCACACCGTCACCTGCGTC
AGGAACGCTGGATTTCTCCACATTCAAAGTGAACCCGAAGAGCTTCTGGAAATTGTCGGAAATACCGAGCTGTGTGTAGAGAACCCATTAGTGAATGTTG
CAAGCTGGCAAAGCAACTTCGATGCCTACTATCGCACCTTCTCCTCCACTTCAGTTGTGCGCTCAAAGCCAGACAGCGACATCTTTGGCACGTTCTTCTC
CGAGTCCTTGGGCATGCGCAGCACAGCTTCAAAACAGCTCTGGACCTGTAGACAGCACAACCAGCAGAAACCTCAGCACCAGGCTACCGTATCTTGGGAT
CAAATAACACCTGTAAAGCAATATACCTGCTTGGCGACCTCGCCTTGCACATACTGCTTCTGCTGCTCGAACTTCTTCGTGCCAACAATCTCCACAGCTT
GGTCAAACAGCTCCTCATGCTCCCTGCAGCACCAGCCCAATATTAATACCCGCAAAAGCGATAGCATTGCGCTTTGACTCCCGCCACAAATTAGGATCCT
TACTTGTTGGCGTTCTGCGGGTCCAGCTTCAGGCTCCGAAAGCAGCTCAGCACCGCGACAACGCCCACATCCGCCTCCTCCTGCTCCACATCCACAGCAC
AATTAGCACCAGTTCAACGCGGCAAGTATATCTAGAGTATATCCCCTCTGTACGACGTAGCAAAATGCAACGCACTTGGAAGCGCCGCGCAGGCGTGGTG
CCTGCGATCCGGAGCTGCAGTCGGCGCCACACGCTCGTCATATTTTGATACACAATGCGACAATTTGCACGGGGGGCGGACTAAATTGTCGCTTTTAGCT
AGACATATTTCTCGCCTTTTAAGGCCGATTAAACTGTCGTTTTTTTCTTTTTTTCTTTTAAAAGTTCACGCATTTGCGGCCAAGAACCGAACCGAGCGTG
AAAAGGGAGCGTGATGGCCAGCACCAGGAGCGAGGCACCCAAGGCCGCGGCCGAGCCGCCGCACCCGTGGGGCCCGCACATGCGCATCGGCAAGGTCTTC
CTCAAGGGCAACGACCGCACTAAGTGCGTCATCCAACCGTGCCTTCTGTCGCCTTCGAGCCTGCCAGGCGATCTAACTATTGAAACTCGTGGTGTCTGTA
CAGGCCTGAAGTGTTCGAGAATGAGCTCCAGGTACGGATCATGCAGCAGCTGAAGGTAGCAGACCATTGCACTGTATCAGCGATCTAATACAAGGTGGCT
ATTGAATCTGTAGGAGGCGTACGGTGCTGAGCGCATCGGTCACTTGGTGCGGAAGCTGGAGGAGGCAACGGAGGAGTTCAAGGCTCTTGACATCTTCGAG
TCGATCAACATTGAGCTTGACAAGGGTTCGCACTGTGTGTAAAGCTATTAGTTAGTGGTATGGATTCTGACGAACCGACTTGTGTCGAATGCAGCGAGCT
CTGGCAAACATGATGAGACCGACGTGACCATCACGGTCAAGGAGAAGGGCTGGCGGTCTCTCCACGTGGGCGCCACCACTGATGGCAACGACGAAGCAGG
AGTACGATGCAGAATCGATTCGAGTATCAGCGCCATTGGAAAGATTATTGACGGTGTCGCTGTGCTTGCATTCTGTTGCAGGAGTCCTCACTTACGCTGT
CGAACGCACTGGGAGAAGCGGAGAAGATCACGTTGAGTGCCACTTACGCGCGTTCGGGCAGTAACACCCAGCGCGCGACGTTCAAGAAGCCCCGATTCTT
GGGCATGCCGCTGTATTTGAGCGCTGTCGGCACCAACGAGCTCCACGTACGTCGTCTCGTTTACTCTATTTTATGGTGTTGGCTACCTTTGGTTAACAAT
CCATTCCTACTCGGGTGTCCTCTCTTTCCAGAACCAAGAATGGTTGAGCTCGTACAACGAGAAGATTCGTGCCGGAAGCATTTCCATCAGTGACTACGAA
GGCGTACACGACTTGTCGTTGAACGTTGGCTGGCGTGACTTGCTCCCTCGCCGTGACCCCAAGATCCCCACGGCCTACCGCGCGTCCCCCAGTATCTTGG
CGGAAGCGATGCCGTCCACAAAGACCAGTGTGAAATATATTTTCACGGATGACAACCGAAACAACGCAGTGTATCCGACCGCCGGTGGACTCTTCAAGTA
CACGTAAGTGATGCGCCAGCCTACCTAAAACCGCAGATTATTCGTCATGATCTGACGTTTTGTATGTATGATGAATAGGACGGAAATTGCTGGTCTTGTC
GGCGATGTGAAATTCGTCAAGGCGGAGGTGGAAGGCCAAAAGCACGTAGCGCTGGGGCCTGTCGTCTTCGGATTTCCGATCCTGAACTTCAGCCTATCAT
ACCACGTCGGAACCGTGAAGTCTTATGGCAGTGAGCAGCACCGGCCTGCGCGCATTAGCGACCGCTTCTTCCTGGGTGGGCCCATGAACGTTCGTGGCTT
CAACCACAAGGGCATTGGTCCGCGCGCTTCTCCTTTGGACGGAGGAGTCGCGCAAGGTGATGCGCTCGGTGGCGACGTGAGCTACAACGGAACGGCGGCC
TTGGGCTTCCCCGTTCCCTTGCCGCTCTTTGCTGTAAGTCTGCAGATAGTCTGCATCACGCTGGAAGTGCTGGTCTAACAACTCCACTCTTTGATTGTGT
GTGTTCGTTGCTACAGGCGCTGGGTCTGCGCGGACAGCTCTTTGCCAACGCTGGCAACTTAACCACGTGGGACCGCCTGCTCGACGAGAAGAAGTGGATG
AAGAACCTTGCCGACGACACGCGTGTTTCCGTCGGTCTGGGACTTGTATGGGGAACCCGCATCGGCCGCCTCGAAGCCAACTATTCGTGGATTCTCAAGG
CGCACGACCACGTGAGGATTTGTGCCCGATTGCTGTTTTCTTGGAGTTGTTGACTAATACGCTCTACTGCTCTATAGGATAACATCAAGCGCGCTCAACT
GGGTCTCGGCATGACGTTCTCGTAGGTAGACCGTCTTAGAGTGCACACTCGACGTAAGGGAGAAGAAGAGGAAGCCAGACGCTGGCCGCAAAGTTGTCCA
AATACATTCGCTGTCAGCATATCCACCGTCACACGTCACACATTTCTGTACGCTACATCCCCTTTCATTTTCGTTACAACCCCGAATTAGGGGGGGGGGT
GATGCCCCGATCAGAACCCAAGAGATCTGCCGCATAGAGCGAAGGCTTCTTCGTTCGACCTCAGTTCTCTCAGTTCTCGACTCTCTTCACCCCCCCACCC
TGAGCATCGCCGACGCCATGTACTCGGGCAACGCAGCGCGCATCTACAACCCGCAGCCGGACCCGCTGGAGCGGGGCCCGCCCAAGCGCGTGCTGCGCGA
GGAGCAGCACATCGGCGAGATGGTGGCGGCCTCCAAGAAGCGCGTGACTTGGCGCTTCACGCTGGGTGAGTCGGACCGCACGCACGAGGTGGTGCTGATC
CACTCGGTTATGAGCTACAAGAAGGTGCGGCGCTAGGCCTCGTGGTGGATTCAATGGACTCGGTGTTCGATAGCTTGTGTCTATTTGAAGTGGACGACGG
CTGATGATTGGGCACTTGTGAATGAGCAGGTGGTGCAGTACGACGGCCGACAGATGCATTTCTCGGCAACGGTAAGGGAAGATTTATCTTAGTTGAAGAG
GCTGACAAGATATGAAAGTGGTTTAACAAAAGATGTGTGGTGCTTGTTGTGGGGTTGTCGGATGTGGCAGGCAACGTTGGGAGACTGGAGCTTCTCGATG
ATTTTGGATGGCCTCAATGTGGTCATGGAAGTGCGTATCAATGACTTGGAGTCAGCCGATGTCCCGAAATACGGTAAGGTATTATAGGCTTGTTCGGATG
AAACGCAGGATGAATGGGGCTGATCACGATGTTGTTGTAATGTGGTAGACTTCGTCATTGACCGAGTCCCGTTCCGTCGCTGGGACGTGTACCGTCGTAA
GAAGCACGCGATCACTACGGCGACCTACGCGCAACCGAATGCTCCTCCTGGAAGTACGTGTTGAATAACTATGCATTAGTTTGCTTGATCTAATAGTTGC
TGACGTCGTGGCTGACGCGGAATAGATGCGTACGGAACACACCGCTGGGGGCCTGGCGGAGCCTCGCCTTCGTCGCAAAGCGAACCCCATCCGTCACGCG
GCTCGTTTACGGGTAGCTCGGGGGGTTCTTTTACGGGCAGCTCTCGTGGTTCCTTTACGGGCAACTCTCCGACGTCGGATCGCACACAGAGCTTCAGCAA
CCAAGGTGCTCGTCCACGAGCCTCCTCTGGGCAGCAGAATGGCCGCACTCGAAGCTTTTCCGGACAGCAAAACGGACAACAAGGGTTCAGCAGTGCGCAA
CAATATGCTGGCCAACGCTCTTCATTGCAGGAACAGAGCGCTCCGATTGCTCCTAATGCCGCAGCAACGAACGCCCACCAACCGCCTCCGGCCCCTCCAG
CGCAAAAGCCCAAGAAGCAGCCTGAAATTAACCTGATCGACGATTTTGGTCCTAGCGTGAGCGTGTCGGCACAGTCGTTGATCTTCGATCCTCTGGCCAG
TGTAAGTGGTTGCCCCCATGGTGGCAAGTTGAATTGATTTGCATGACACTGATTTGTATCTTGTGCTATGTGTTTGCAGGCTAAGATATCATCGACGGGA
GATTCCACAACCGTGGCGCCTCCTCCTCAGCAGCAGCATCAACCGCAACAAGCTCCTGCTGTTGCTGCCATCCCCCAGCCAACGGCGTATGTGGATCCGT
TCGCCGCTGTTGCTGCGCCTGTAATGGCCAAGCCAGCCGGAAGCATCAACTTGGATCCATTTGCGGCTCACAATGGTACCTACCAGCAGCAGTCACAGTC
ACAGCAGCAGCCGCAGCCGCAGCCGCAGTTCAACCGTCCGATGGGAAACATGATGAATCAAACTCCCGTCTATCAGCAGCCAATGGGGATGGCAATGGGT
GCACCGATGGGAGGAATGCCCATGCAGCAACAGCAAGGTATGCGAGGCTCCTTCACGGGCCAACAACAGCCCGGTGCACCGAACGGCATGGGCGGCGTGA
ATTACAACATTTCGCAGCTCATGAACCCGGCGAGCCTCCAAAGCAGCCAGCAGAGTCAGCAAGGCAAGTCCATTAACATCGATGCTTTCGCTAGCTTAAG
CCGCTAGCAGACCGCAGCAGCAGAAAACGGCAAGGGATTGCCAGCACCATGTTTTGCCTCAGCTCAAATGTCAAATGAGTCGAACATTCACTCCCTGCAA
GTTTATTTTTTGAGTTAGCGGCGGCGTTGTCGTCTACCAAGCAGTTCGTGCGTCTCGCGGTCGAGTTGGCTTGTCATCTGGAGCCTCATCAGTGCACGTA
TGTACCCGATCTCGGCGTCCTTCTTGGCCTCGAGCTTCTCCTTTAGAGCTTCAATTCGTTGGGCATTCTCCAGCTCAAGGAGCTCTAGCTGCCTTGCGTA
CGTGTCTGAGAGGACCTGCACGTGGTCCTGCAACCGTTTGTCTGCTTGTACGGTCCATTGTTTCTCCCGCAGCTTGACCTCGGCGGCGTGGAACGACTGC
AACTCGTTCGTACGCTTTTCGAGAGCTGCAGGAGCACTCCTCGCTAGCTTTCGCGCGGCCGCAATCACCTGGTCGCATACTGATCGTTGCCGCTCTAGTT
CCTGCTTGCAAGCGTCGAGCTCGGCTTGCACTTGCTCAGCCTGGCATGCAACATCGTGTTGGTGAAGGAAAATGCCGCGGAGCTCGAACTCTACTTTGGC
CAGGAGCCGCTGCAAGTTGGCGCCCAGCACTGCAAACCCTTCCAGCTCCTCGAACTCCTGGAAGTATACCCGCACGCGACCTTGCGCGCGCAGGAAGAGC
TGCTCCTCTACAATTGTCAATCGTGCACTGCGGCACGTCGAATGCTGACATCACGCCTGCACAGCGAATGCTTCGCTGAATAATGGTGACGCGCTTCCTG
CTACCGCCGGGCTTGGACCGATACGATACACCTCTCACAAACAAGCCGTTACGTGGCAACGAGCACGGCCAAAAGCAAGTGAACGAACGAACGCGTACTT
TGGTTTGGTGACAGAAATCGGCTCGTATTTGCCTCTATTGGAATAATTTACAGGCGCAGCTCGTGCCGCGGTCGCTGGGGGTCGGAGCGCAGCCGAGCTG
CGCGCCTTCTAATTTACTGTACGCCACAACCAGTGTCGTTGGTGCTCCAACTCATGGCCGACGTGTACTTGCGCGTGGCCTTCTCGAGCGCGATGAGGTG
CGGGTCGCGGACGTGTAGTGCGCGCATGCAGTCGCAGAGCTTGAACAGGTACTCGAAGTTGGGGCCGCTGAAGCCGCTGCGCGTGGCGATCTCCTTGGCC
ATCTCGTCCACTGGGGAAGGGCCCAGGAAGTCCGAGTTGGAGGGCGTGGCGATGTAGACCAGCGCCTTGCGCACCACGCCGTCCTCGCAGTGGACGTCCA
CCATTTGGCGGTCGTAGCCGGCCTGCTCGCGGTTGTCCAGCTTGGTGAGCGTGTCCTCGACCTCCTCATCGGGCACCTTGTACAGGCGGCCCCACGTGAT
GTGGTCGCCCGCCAGGTGCGCGTACTCGTCGTCGAACTTCTTCATCTCCTCGCGGCTGATGAGCGTCACGACGCGGCCCTTGGCCTCGGGCGAGCCGCGG
TGGTCCGGGCTGCCCTGCCAGAAGCGGCGGTGCCAGCCCTCGACGTAGCCGAACACCGTGTCCTCGGCGGGGAACTCAGTCTTCCAGACGATCGAGCCGT
AGCCAAACACCCACATGGTTCTTGAAGGAGAGGTGAGGTGTTGAGTTTACTGCTGCTGCGCGGGGCTCGATGTGCCGCGGAGGAGGCGAATTCCAGAATG
AACTGCCGCAAGCAGGCTGTTGCAGGCCGCTGGTTGCCCTATCCTCAAAAATGTCCAGTTGTTTGGCCAAAATCGGCCAAAAGAAAATTCCCATTGCGAA
AGGCGATGGGATTGGAGTGGAAAATCCCGGCATTGAGCGGGGCCCCGAGTAAAAACGCACCAGCCCCGCGGCCGGCAAACGTGCATGCAGAGAGGGCGGC
GCGAGACCCCGACCATCGAGGCCTCTTCGACCGAATCGATTGCTGCCCGGCATCTCATCGGTGAAAGACTCCGCCGCGCAAATAGCAACAGAGTCTGCAC
CCCGAATTAGGGCGAAGCTGGCCTAATCATAGTTTCCAGCGAGATACGCCAGCAAACCAGTCCCGAACCAGGTCGCGGCTGAACCCAGCGGGGCCAATTG
CGCAGCTTCGGCTGCCGCACGCAGGCCATTCATACCGCCGCCGCGCGCGCTCCTCCGTATCAATTGCGCCGCGAAACAGCCGCGCGGATCTGCTCCGGGA
GCTGCTGCTGCCACGTGCACCGAGAACGCCGCCAGCGCCGCGCTCGCGGAGTGACGTGCAGCGAGCGACATTGCGCAGGCCGGTTGATGCACGACAAACG
GTTTTTATGCCAAAAACTGCACTTTCGTCCGGTTTGTGCGCGGTGACTTTTCGGTGACCAATGAGATCAAAGATCGCGGATGACAAGATGCACCTCTTGT
TACCGTGGTGGTAATACGGTCTCCGATTGGGGTACGGTAGCAGCAGTAGTACAACCTCTATCTACTAATTCACCCGTCTAATTGACATACTTGATATGTC
GCAATTTGGAAATATAGCGTCTATTACTAACGCAGTGGGTGGTGATATACCGAGGTACTGTACTAGTCCTCTCAAATTCTATTGAAAACGGGAGCGTATC
GGTGATAGGCCAAAAACTATCCGCTCACCCCCATCCCCCTCCACCACCAGAACACCATGACGATCCATGAAAGCTCAACGGCGGCACCAACGGAGACCAT
GCGACGGCGCTGATAGGCTCGGTGGAGGCGCAGAAGACCCATGCCCCCGCTTCATTGGCGCCGCCGTGCCGCCGTCACAGTCCGGCGCGAAGGAGGGACC
TCAAGCCGGCCGGCGCCCGCGGCTCTTGTTCGGCGATCGATGATCGCGAATCGCCGATCGAGTAAGCCCCATGGTGCTCAAGTCGGAGAGGAAGCTCGGG
CGCGGAGCCTGCAGCACCAGGCGCACGCCGAAAGAGTTAACGAGTGTCGGCAGACGTCCGCACGTGTCGGTAGGCGTCCACCAGCGTTATGTATTATCAC
GGATGAGATGTCTTCCGACCGCCCGGCTTGATCACATATCGTGAAAACACGCAGACCAGCCTTGCCGCCGTTGCAGGAAAGACATGGGGAGACTCAGCAA
GCGCTGAAGTCGGGAATTTCGTGGGTTGTGGCGCAATCCAATGTCTACTCGTACCATCCTTCGGACGGACCTTGCATGGCATCATATTCACTGCGGGTAC
GATGAACCGCAAAAGACAAAAAATCAACGCGACCACGGATGATCACATGTGGCGCGCCATCAAAGGTTTCAGCGTACTAACGCCTTTGTATGAAAGCAAG
GAAAACCAACGACGCAGTTCTGTAGGCAACCGAAGCAGCCATCCTCAGCAGCAAGTGTAGCTCGAATAACTGAGGAAAATGCCACGGTTCGACTCCGCCC
GGAGCAGTAAGGCCGATGAGGAAAATTTGACATGACAATTTGACCCGGGGGGCAAATGTGGATGCCTTTGTCAGCTCGTACGACAGGAAAATGGAGCGAC
AGCGTTCCGGACTATCTTGGAAAGCATTGACGCAGAGTCGATTTCGAAGCGTGCATTCGCGGGGGCATTGGTTTTATGGATGAGGACAACAATTTCGATC
TAGCGTTGAAGGACATGGGATTGCTACCGAACATGTGGGGAATCCCCACTGGTGTATTGGGTCGTGACGTACTTTGGCTCACCAGGGCACATGATACTTG
AGGTTTTTGGACTGTGAAAATACCGGCAAGCCAGCTAGCAATGCGTACTGAGGCATTCGTTGTGCAGCGGCGTAGCTGCACCATGGCAGACGTCTTCCAA
ACAAATGAACGCACTATTCTAATCGTTGTTTTCACACTGAACGGAAATGCACCCTCTATTTCAAGTAATTCGAAGTCGTATTGGGAGCAGGCCCTCGGCA
GTGATGAATGGATTATTGACCTGCCACCAGTGGAGGAGCGAGACGGCAGTCAACGACGACATCCCTGCTTTGACTGGTTTGGTCATGATAACGAGAACGC
TCAACAACCCACGTGGTGGACTACGGTTCGACAGCAGTTGGATCGCCTTCAGCTAGCCGTCTGCGAAGCCCCTAAAGGATGGCAACGGTACCCCACTATG
ACGAAAGGAAGCAAAGTATGGTCAGAGGCAGTGTCCTATACTATGGGGCAGGCAAAGGTGTTGCATGAGTCGATTTTCTTGAGTACCTGGGTTACCCTCC
GAGAGTACTGGGAGTACAGCTGCACCATTGATGCTAATGAACGATCTCAACGATATTGCCAAACGCTTTTGAGGCATGTGAACCTGGGAATCAAGACGAG
ACGTCAGCAATGGGCTCAACGAACTCAAAGCCAACTGTCCCGCCGCCTTCAAGAACGAAGAGACCAGATTTGTGAGCGTGGCGAACGCTGGCATGAGCAA
CGAAATCACCAACTTGGTACCGACGGCACGACCTAGCTTGTTTGGTGTCAAGATCTTTAATTTACTGCATATATGCATATGACTTGGGCAGCACTGGCGA
CGCAGTCTCTGCGACTGTGTGATCCGTGCTGTCATGTATGGGCGACTACCGTGGGCGCGTGTTGTTCCAGCATGGATCCGTCGGCGAGGCTGCAGCAGAG
CGCAGTATCGGGTGCAGTTAGCCGACTAAACCGCAACAAATAAATAAATGGCTCATTAAGCGCCAGATTCCTCGCATCGTCGGGCAGCACCCAGCCGACC
CAGACTTGACATGCAGCCGCAACAGAACTCTGCGTTCTCAACCAGTAGCAACAGTCGAAACCGGCAGCAGAAGTGGCTCAACTGGCAGCAGTTTTTCCGC
TATCAAGAGTGGGTGAAATATGGTGTAGTGGTGGAGTCAGCCGCAGCGACAGCATTCCTCGACTGTGTTCTTCCCAGCGCAGCCGCTAAATGTTCTGCTT
TCCTGCTTGGAAAAGCGCTTCAGCACCAGCAGCACAACCGCCGCAAATTAAGTTTCCTTCGAACAATCAATTTTTCATTCCGAACGTGCTGCTAGCCAGC
CGTTTGTTGGATTTGTCGACGTAGAGAACAACGATGGCATGATGCTGAAGCTGCTCGACTAACAGAACAAGTGTATGGAAAACGGACTCGGCGGTACGAA
GACCGCAAAACTTATAATAGGGGTTTACACAGAGCCTCGGTTAATTCTCTAATTAACACATTTTTTACCCACATACACATCAAGTTGTTTCACCAGTTCG
CTTCTGTAACTACTGTACATTTGGCGAATGGGTTGCCGACAAAAGCTTGACTCGAAGGTGTATGTTGCTGCTTGTGAGAGTATGGATGTGCCAGGGATGC
TGCCCACGACTATTGTTTATCTCGAGCGTTGTCGTCCTCGGAGGCTCCATTCTGGTTACGAGGGGCTCGGTATTTGCGTGGATACGTTTTGGCCTGTTAA
GTTAACGAACGTGTTTTCCTACGCGCGTACGACTGCGATTTCATATTGTGCTACGAACTGCGCGGCTGCCCTTCCGTGGCAAGGAAGATAAACTGTAGTT
GTCCACATGCATCTTGACGGTCGATACATTTTTTTAACTACTGTAGTTGCGAGTCGCTGTGTTTCCATTAGATCTCTAAATCAAGCATGGGCTTGCGAGT
CGAGAGTCGACTCGAACCCCTGTAACACCACGAACGATAACAAAACGGCTCGTAAAGCGGATCTTGGCGATAAGCGTTCAAGATCTTAAGAAAATTGCTA
GCTGACGATACCAGCAGTAGGATGTAAGTTATCCCTACCTTCAGTGCACTGCTCTTGCTTGAACATCGACTTCATACAAGTCGAATAATGTCGGCGAAAC
TGAGTTGATATTGTTAAGCTTTTCTAAGCTTGGTGTTCCTAGTGATCGTACGCAACACCGACAAGCTCCTTTCCGATCAATCTATGCAGACCTAGATAGT
TGTCCTCAGCATGATGTTCAGGTCATGCTTAAACGGTGTCTGCGATCTGGTCTCCTTCGCTTGACAAGAAACCCAACTCATCTTCCTCGCAGATAGAGGG
GCAGTCACGCAGAATCGCGTGCGAAATGGCGAGTGCTCCGCTGAAATTTGTAGCACAATACGAAAGCGCAGTCGTAAGCATGATGAAAATCGCGGTCGTT
TGCTTGCCAAAAACGTATCCAGCAAACCTACCTAGCCGAGCAAATCGTGAACAGAATGGAGCCTCCGAACACGACAATCACAGCAGCGCTCACTGCAATC
ACCACGAGACAAAGACTCCCGTGAGCGACATTTTCGATATAAGCATACGTTCAAATGCAAGAACAAACCTCCGAGCATGCCCAGCTTGCGCTGGTCGGGC
GTCACCGTGCGTCCCATGATCTTGGTCGGGTTCTCCGGCGACTCGTTCGCCGTCGCGCTCGACATGTAGATCCAAAAGCCGCCCAGGCAGATGAGTACGA
ACAGGAAGAACGGGTTCAGGAGGCTGCATCGAACCGTTACGCGAAGAAGTCAGTATAATGTTCATGCTCCTACACGAGCACATATCAAGTGTCTACGTAC
ATCGTGACGACGCCGACCAACGCCGCGGAGATGGCGTAATTGGCACTAAAGAACAGCGCGTTCTTGCGGCATCGGGAGGCCAGGACCTCACGTCCAGGCA
CATTGAAGGGCTTCTCCTCGCCTGCATAATTCCCACACAATTGAGCGCAGCACACCAGTTAGCGAGGTGATATCAATACTGGACGCCGAGGTGATCAAGA
CGTACCGAATCCAAAGAACTGGGAGATGCCGCGCACGTTGCGGATGTCGACAGCCTTCATGAGCTGGTTCCTGATCTTCTGCAGCGCGTGCTGCTGCGCC
TCCATGGTGATGGTTCCCTGGGGCTCGTCGGACGCGACCTTCATGGCGCTAATGGCGGCTGCTTTGCTCTTTGTGTGATCGCGGGGGAAGAGAAATGTCC
CGCGCGCAGAAAAACTGTTGGCAAGCTGCGGTTCGCCAAAAATAACAGGTCACAAATAGCCAATCGTCGACCACCTAAGATCGCGAGGAGTGATTGTCAC
TTCAACTTCTGCAATTTGGCGCGCGCGCACTCGCGAATTCAGGGACAATGCGGACGCGCGGACAGACACCCAAGGCGCCGCTCAAGAAGACGTACGAGCT
GGACGACACGCCCGAAGAGGACAGTGAGTGGATCTGCCTACCTTCGTCTCTGTTGCATTGTCTGGTTGATACCTGGACAACGGCGAGGGCATATATAGCC
GAGGAAAGAATGCAGTTACTTTTGGCACTCGTGCTAACCGTTCTCTCCTCTCTTAACGTCGCTGTGTGACAGACAGCTCTTATGATGGGGATAAGGTAGT
CGAGGAATCGGTGTGACGGGTTGATAAAGCGCTGACATGCCGTTCCGTAGGAGAATGCGGTGAATGCGGCGAAACCAGGCAGGAAGAGCAAGCGGAAAGG
TGGCGCAAGTCGTGCAAGCAAGAAGGGGTTGTCGAAGAGGCAGAAGAACGACAACAGTACTGCGAGTCAAGAGTCGCCGCCGAGCTTTGCCTTCAAAGCG
GCCAAGACGTCGTTTCGCAAACGGAAGCTGCTCAAGCATGAGCGACAGCTGCAGAACGAGGAGGAAAACAAGAGACGGATCGACGAGATGATTGCGTACT
TCAAAAACCTGGATGAGCAGAAGCTGGAGACAGCGTGATCTCTCGCAAGCGGAAAAGCTTTCCGGGCTCGTTCGTGTTTGGTGGTGGCTCGACGAGTGTG
GCGATGTTGCGTGCGCTACCTGGCTCTAGATCATGATGATGATTTTGCAGTCGCTAACTCCTGAAGCTGGTCACAGTAGCGAGGACTTTGATGGCGATTC
CGGTTCTCTTCAGCTTTCTTCGCCAGTCGGGGTGCGTCAATGGCAACCGTTTCCTTCAAAACATCGAAGACAGCATCCTAAAAACACAAGCATTACGTTT
TAGTCGATTGGATGCACATACTCAAGCATCAAGCCGCATTCTTGCTACGCTTTCTTACCTGGATATCGGGCTCCGAATCATCGAGGTGAACAAAAAGGCA
GTCCAGAGCATAGTCGATGATCGTCCCTTGAAAGTGCTCCTTTGGTGCAGCTTGAAGGAAGGTGGCAAATGTCTGGCAAGCCGCTTTGCGCACAGTGTCG
TTGCTATCATCGAGGCGCTTCAAAATCTCTGCATAGAGTTGATGTACTGGCTCCTCTGTTCGGCCCAACACAACACGTCGTGTGTAAGCGAAACTGTTCC
GTTTAGAAGACATTTACGTTCGACATACCTCCCAAGCACCCAGGTAGTGCAACAAAAAGATACTGGAACGCAAGGCAAACCAGTTGGCGAGTCTTTGCGT
CACTGTCGTCCATTGACGATTTCAGTACAGGCAGCATCTGCAAGACAGCGAAAAGTATTAGCAAACCGTAGATAGGAGTGAGCAATAGCTAGACCATAAG
GTACCTGGGGTGCAGTCTCGAACAAGCACGGTTGGTCCGCAATACCCTGGCGAAGCAGCGTGTACGCACATGCAACAGCTACTTTTCTGTTGGAAATAGC
ACGAGGGGGGGGGGGGGGGGTCAGCAGGTGCATAATTTTTTCCGAGCGCAATGCAAAAACCAACCTAATGGTTGCAGCCACACGTCCTCCACGCCAAACG
ATGTTTGGAATGATAGCTTTTTGGAGCAACGAGACGCTAAATGCCTTGAAGGACTAGTAACAACACAATACCCCCGTCAGAAACTCCACCACGGAATCGC
AAACTACCTCAGATCTGACGTACCTGACTAATAGCATCCGTCCCTAGCATTGTCTCCAACAAGGCAAGGAAAGCGAGGCGAACATCTGCATCCTGGGCCG
GGTCTAGGTGCAGCAGAAAGACGGGCACAATTTTCTCCAGATTCTCGCCGCATGCCTGCATACATGTACAATTGGGATACATCATCGTCAATGGAAGTAG
GGTGCGTGCTATCAAGGATAAAAGACACTTACCGCTCCCCCACGCCGACAGATTGAGTCGAACAATACACGGCTTGGATTGCTTTTCTGCCAACTCGCAG
TTGAATCAGCCGGAAGCGCCATCGTATGTAAGAGTTTACCCATGTAGCACCCGTAAAGCGCCTGCGAAAACAGCGATATGGGGCAGTTAGAAAATTATTC
ACCGACACATGTAATTGCATCGTGGTTAACTCTTACCTCAACAGGTTTCTCCATTTTCACTGCTAGCTCTTCCATCGCTTCGGTTGCCTGATGCATCCAG
TGTGTAGTTAGTATATTAGAAGTAAATGTTAGCCCCGCGTTGTAGTATATCCCAGGCTCAATTGCATTTTTCGTGATGGCAACTTACTGTTTCATAGGCA
ACCGACGATTCTGAAGTCGAGGCGAGGAGGTGGCTCAGTACCCAAAACAGTCGGAAGCAGACCTCGTCTTTTTGGGCAAGCAGTGGTCCGGCCGTCTTCA
CAATACTTGAGACGACGCCAGCCAGTTGATCTTGAAGGTCTGCTACTTCGGATTCACGAAGACCAGCATCACACAGTGCCTCGGTAATAAGCTAAACGAA
GTTACCGTACATAACAAGGGACGGTGAGTAATTGTGTTAAGAAGATGCTTCGACTAGCAATCCGTACCTCCAGGTGGGCTCCAATAGTATTTGTTGTCAT
GCCCTCGATGCTCATACCCAGTAGGATCAAGCCGTTAGTACGATGTTGTGCGGTATCCTGTCCTGCTAGGCGACCCGCCACCATCGGCAGCAAAGAAGCC
AAAATCATTTGAGTGTCAGCGTAGAAGCCGACAACACCGGAGCACGCCTTCACACTGTTCAAAACGGCCTCTTCATCATCGCGGCAGGTCTTGCCTAGCG
CCGCAAAAACCTTGTCGAGCAATGGGTTCATGTTTTGCTCCAGCAAAATCAGGTACGCACTGAGAACTTGCGTGTAGCGCTCACGCACATGCACGGTCCA
GTCGCTCGTTTTTTCGAGAAGAGGCGGTAGGACCTGGGCTTGAATACTCGCAGCAAGTTTACGAGCGCCTAGCGGAGGACGAGTTTCGAAGAAAAGTGGC
GGTACGCTCTTTGCTGAGTCCATATCCACCTCCATTAGCTCCACATCGCTTGACTTGACTCCTCCATCGTCATCACGACCCTCCCAGATAGTCGAAAGTT
CATTCAGCTTTGTGAGTGAGCTTGCTCGTACTTCTGGCGCATCGTCTGCGATGCCTGCAAGAAAAATTGGGAAGATGGAAGCTTCGAACTGCTGGACCTG
CTCGATCTGAGCCAGCCACGCAGCCAGTGTGATCACCAACTGCTTTCTTACAGAGGGCGCGTGATCAAACACCACCTTGCTCACAGTCGGCAACAGCACC
TCCTTTATAAGCTCCGGTAGAGCCTCCGATCCGCACGGTACCGCAGCTTCCAGTGCTTGCAACGCACACACGCGCACACGGCTGTGCTGGTGGCCAAGAT
TCGCCACCATGGGGCGCACAATGGTGCCGATCTGCATCCCAACATCGCTCTTCCAATTCTTGGAGATCAGGATGACGCACTCCGCCGACATCTTCTTGGC
ATCAGGAAACGGGTCCACCGCGGTCTTGCCCAATGCGTTGGCCAACTCCGAAATGACGTCGCGCAATGACGTCGCCACTTCCTTCGCCGCCGCAAGCTGC
TTCAAGAACGCGTGCAGTAGCTGCAGAATGAGCAGGCGGATCTCCTCCGTCGGCTCCGGGTACGGCAGCTTGCCCAGACGAACGTTGGCCAGCGCCACCA
GCTCCTTCAGTGTAGCCTGCGACGGCTCCAGAGCCCCGTTCTCGCACAGAAAGAGCAGTGAAGTCAGTGCTCGCTCGCGACACTTCTCCACTGCGTCGCT
CTCGGCGCACTGCAACAATGGGCGCTGCAGGTTGGCGACGCACAGAGTGCGCAGCACCACAGCAGACACGCGCGATGCCTCGTTCTGCAGCGTGCGGTGC
AGCTTGTCCGCTGCTCGGCGGCGCACGCTTCGGTCCGGGTCTGCCAGGCAGTTGACGTCACGCTGCATCTTCATGGACAGCATGTTGTACGCGGCCTCGT
CCTCCGGAGACAGCGCCATGGCTCGCGAGGCGTCGGGATCCTGTGGCCAAATGACCCGCCACTCACCTGCAGTATACAAACAACTAGTGTGGAATGCAGA
GACCGTGTGCTCGAAGATCGTGCAACACTACAGCGCCACAGCAACATTACACTTGTTGCATGACGGATTATGTTGCGCCGAGTGAAGCTGGACAAAGTTG
TCCACCTTGGAAAGCATTGGGGCGCGTTGACACGAAAAGAGATACGCCATGTTTGCAAGTGCATGCACGCTAGTTGCTCTATGTGTTGGTGACTCGTCTA
CTGTTGCCTCTATACATGATGAATACGAATTGCCCAGGCCTCCGGCGGCGAGCCGCCATGGATGCTGTCGGTAAAATCGCCACGCCTTGCCGAGCGACGA
GCTTACTTCTTCTTGCCCTGCATGCGCTTGCGGCCGTTGGCGGTCAGCTCGCGCTTCCGCATGCGAATCTTGGTCGGGGACACGTCGATCATTTCGTCCT
CACCAATGTAGGTGACGACGTCTTCCAGGGACATCTGGCGGATCGGCGACAGCTTGATGTTCTCGTCAGTGCCGGCAGCGCGCATGTTGGTGAGCTTCTT
CTCCTTGGTGGGGTTGATCTCAATGTCCGTGGGGCGGCTGTGCTCACCCACAATCATACCCTCGTACACTTCGTCGCCAGGCTTCACGAACATCTCACCG
CGGTCCTCGAGCGAGTTGAGCGCGTAAGCCTACAATGAAAAATTGAGTTGCCGAGTCCGTTAGAAACTGCTAGCAATGGATTTCCAGGTAGAGACACCTA
TGCTTACCGTGCACACGCCTCCAGATGAAGAGATAAGCTTGCCCTTCGACGGAGGAGTGGCCGAGCCTTGGAACGGAGAGTAACCGTGGAAAATCGAGTT
GAGAATGCCACTTCCGCGTGTGTCGGTCTTGATCTACACATGATAATCAAGGTGAGTTACCTACACATTTACTGGCAACGGGAGATCAATACGTACCTCA
CTGCGGTAGCCCATGAGGCAGCGACTGGGGATCTGGAACTGAAGACGCACTTTGTCGTGCATCTCCTTGAACTCGATGATCTCACCTCCGCGAGTGGACA
GCTTGTCAATAACAGTACCAGAGAAGTCGGAGTCGACATCAATCGTCACTTCTTCGATAGGCTCCAGCTTCTGGTTCGTCTCGGGGTCCGTCTTGAAAAT
AACCTGGGGAGCCGACACGGACATCTCAAAGCCCTCGCGACGCATCTCTTCAATCAGAATGGCCAGCTGAAGTTCACCACGGCCGTGGACGTCAAAGGCT
TCCGAAGAAGTGCTAGGAGAAATGGAAATGGCAACATTGTTCTGCAAACACCGATAATTAGCCATCTAACTGTGGATAACAACATACTATGCAGGTAATA
CACTCTTACCTCGCACTCGCGCTCAAGACGCTGCTTGATGTGAGAAGACGTGAGGAACTTGCCATCCTTGCCTGCGGTCGGCGCGTCGTTTACGCCAAAC
GTCATCGAAATGGTGGGCGGGTCCAGCTGCGGGGACGGAATGGGCTCCGTCACGTTGACATCAGCGATGGTATCAGACACGTATGCGTTCACACCAGCGA
TGGTGATGATATCGCCTGTTGCATAAAGTCACACAAACACCAGCGCGAGTCAAAGCACTTCGGTGAGCAAGTGGTCGATGATTAGAAACGTACCAGCGGT
GGCCGACGTGATTTCCGACTTGGCAACACCACGGGTCACAAACATCTTCGTCACCCTGCCGGTCTCGAGCTTCTTGCTGTCGCGGTTCATCACTTGGATC
GAGTCTCCAATCTATTGAATTCGTTTCACATGCAACACGCAACAAAAAAATAATCAGCACATGGTCACAACGTACAAGCCAAGAAGTGAAGAATGCGCAC
CTTGACAGTTCCAGCGTGAACGCGGCCAGTCGCCAGACGACCAACGTACGGGTCGTGGCCAATCATGGTGACAGCCATCGCGAACGGCTTGCTGGCATCG
GTGTTCGGTGCAGGCACGTAGCGAGTGATCTCGTCCAGCAGAGGCAGCATGCTGTCGCGGGCCTCGCCCTCGTTGTCCAGGTCGTGCACGGCCCAGCCCT
GCTTGGCAGACGCGTACAGCACCGGGAACTCGAGCTGATCGTCGTCAGCGTCAAGTGCAACGAACATATCGAAAAGCTCGTTCTCCACCGAGCCGTCGAG
GCGGCTGGTGTCGCGGTCCACCTTGTTGACGACCACGAGAGGCTTCAGTCCGCGGTGCAGCGCCTTCGTCAGCACGAACTTGGTTTGCGACATAGGTCCC
TCCGTGGCGTCCACAACCAGGACCACACCGTCCACCATGCTCAAAATGCGCTCCACCTCACCGCCGAAGTCAGCGTGACCGGGGGTGTCCACGATGTTGA
GCACGTGGCCGTTGTACTCGACGCGCGTGCACTTGGACATGATAGTAATGCCGCGCTCGCGCTCCAAGTCAATGGAGTCCATGACGCGCTCCTCGGAGAG
CGTGGTGCCGCCGTGCTTGAGCAGCTGGTCCACCAACGTGGTCTTGCCGTGGTCGACGTGTGCAACGATAGCCACGTTGCGGATGTTCTCGGCCGTGACG
GCCGAGTAGTCGGTGGAGAAGGCACGCGCCATTGCGGGCGCATTGCGCTGCAGCAACGAGCGCTGGCTCGAGCGCGCACGCGTCAGAGCAGGCAGGCAGG
ACCGGCGGAGCCACATGATCAGGTTCAGGCGCGTTGATGCACGAGGTCGACAATCGAAGCGCGTGTGTGGTGGAGAGCGGCGCCGACAACATTGGTGTGT
CGTACCCCATTTAGTGTAGTAGACGCAATTTCGGTGGTACAGTCGTAGGTACAGTGTGCCCGATTGGCGTTCGATTGGAGTTATATTGGTGTCCGATTGG
CGTTGCATTGGCGTTGCGGCCCGACTTATGGCGCGCCCGAGCCATTTCCTAATCCATAAGTCAATCGAGCGCGGCGCCATTTGTGTGCGTCACACAAAAT
CGATTATTGATATCAGACCGCTTCACACGGCAAACGCCATCGAGTGCGTGACGAAGGCAAACGCGTGCAGCATCGGGGAAGATGCTGATGCAGTCGCCAG
CCGTGTGCTAGAGGAGAGCAGCCCATGCGCGAGACAGTCTTTTGCTGCCCGCTGGTTCAGCAAACACCGCGGGAGTTAACATGCGAAAGAAATACGCCAT
ACACACGCCGGGCGAGGGTGCTTTCAGTAGGGTCGTGAAGCCGAGGCACGCCGCCGTAATGTGCTCACTGCGTTGGTGTCTCACCGACAGTGACTACATG
TATTAAAACGGCGGATTGATGCGAGGAATGCCACCACTGAAAGGGCACACAGTTTCGACAATGGACCATTGGCAACACAAATGGTGAAGACAACTGGCAG
CTCGTCGTTCGAGACTCGTTGATGGTATCTTCACTGAAGTCAACGTGGCGGTGCCACAGGAGCTGGGGTTGCCTGTCTTTTATGACGACTCGGCTCCAGC
CGGCAGGTCTTACTTTCGCGGTGTCGCCTGCGCCTGTGCACGACGGTTCGAATTTTGAGTGTCAAAATGAAATGCAAGGCAGCGCGTCACAGCAGCTGAC
GAATCTTGGCGGGGTCAACGTTGCAGGATGCACCATGGTCGCGGCTACGGATCTTCGCATTGGCGAGACGCTGACCCATGCAGCATGGACCATGCTAGAG
TTGGTGCCACCAACTTGGTGTTTCGCCGGGTTCACATCGTGGCGGCGCTGGTGCTTGGGAAACATGAGCAAGATGAGGGGCTGACTGGCGCAGCGTCTTT
GGGGGAGGCGGTGGCTACTTATCCCGCGATTTGACGCCCAACTCCAACATCGCAGCCCGATTTCTAGCGAGCGCCAGACTCAGCAGAAATCCAAGCAGCG
CCGGTGGCGGATCAAGCGCTCCGGATCCCAGACGCTGCGCCGGGTTGTCTGCCCATCGAGCCCCATGCTGCTGCTGGCTGTTGCCCAAGGCAACGCAGTA
AATCAGCTCCGCCCGACGACGGGATGGAGTCGCTGAGCGGAATTCGGAAGCCACCAAAAACCGCGGCGAGTGTGACATTCGCCGCGCCTCTGGCGGCGGC
CGCTGCCTCGGCGTGAGAATTCGCGAATGGCTGTTTGCGTGCGCAGCTCGGCCCCGCCGCGAGGTAGGATACCAGCGAAGGCGGTATCCACCCGTCCTGC
TTGGTGCTTGGGCGCTCGCGAACGCCCAGCTGTCGCCGGTCCCCCGGTCGGGGTCAACTCGAGCTTGGGTGGCGGGCAGCGGAGACCGAGTCAGCTGCGT
TCCCACCTTCGAAATTGTCCAGCACAGCGCGGGCCGGGCCGCGTTACACTGGACTTTTGGCTGGCGCGGGGCGGCAACCCGGCCCGGGTCGGGATCCGCC
GCGCAGCGTCTCTGCGAAACCAGACACAGGTCGTCCCCTGCTGGCAGCAGCGCGTGATGCGGAAGATCTGCCCGAGCCTCATTCCTCATTTTGCAGGCTG
GCGCTGCCCCTCGCACCTCGTCGCTCCCAGAAGCCCCACAGGCGACCCCCATGGCGCGCGCTCGGAGCCCGTGCGCGGCGCGGCTGTTGCCGCTGCTGCT
GGCGGTGCTGCTGGTGGCGCTGCTCGCCGCGCGCAGCGAGGCGTCCAAGCCCATCACGAACGCGCTGCAGCGCGCGCGACAGAACCTCACGGCCTTCCAG
CGCCAGTGGATCGACCCGGACACGGACCCCAAGTTCTACAACGTGTCGGTGCCCAAGGGGCCGTTCAACTTCGGCGGTCGACTCAACGATACGAACGAGT
ACACGCTCATCTTCTCGGACGAGTTCAACAGCTCCAGGCGCACGTTCGAGGCGGGCTTCGACTCCAAGTGGACGGCCATCGACATTCGCGACACGACCAA
CATGGGCCAGCACTACTTCCTGCCCCAGGCCGTGCAGATCGACAAGGGCAACCTCATCATCACCACCTCCAAGCCCAAGGAGCGCTACCGCGGCGCCAAG
TACGTCAGCGGCAGCGTGCAGACCTGGAACAAGTTCTGCTACACTGGCGGCTTTGTCGAGGTCAAGGCCATCCTTCCCGGTAAGTGGGGCATCCCCGGCA
CGTGGCCGGCTATCTGGCTCATGGGCAACTTGGGTCGCGCGCCGTTCGGCGGTTCCCTGGACGACACCTGGCCTTGGAGCTTCGACGTGTGCGCCCCCTA
CGTGGAGAAGGGCGAGAAGGTCAAGCAGAAGATCAATGCCTGTGGCAACCTCACCGACAAGCACGACAAGGACTCGTACCCGGAGAGATACGGCATGAAC
CCCTTCCAGGGCCGCGGTGCCTCCGAAATCGATGTGATTGAAGCTCAGATTCGCGCCCGCGATGAGCCGGCGTACATTTCCACTTCGCTCCAGATCCGCC
CCAGTGTCTACGACGATATGCGCCCCTCCCCTGACACGCTCCCTGGACCGGGTCAGTGGTACCAAGGCCTCAAGTATGGCGAGTTCACCAAAATCAACAG
CGCCTACTACGGTGACTTGGGTCTGGACTCCATCTCTGCCCTGACGCAGCTCGAGTCGAACGCGTTCAAGTCGTACCACTTGTACCGTCTTGACTGGTCG
CCCGGTCCGGAGGGATACATTCGTTGGTGGATGGACAACAACTTCTTGTTTGAGATCCCCGGCGAGGCGTTGAACAGGTGGATGGGCGGTGTGCCGCCGC
GTCAGATCCCGGTGGAGCCCAGCTATCTCATTCTGAGTACGGCCGTCTCGGAGAAGTTCTCGCCGCCGTGTGAGGGTCAGATCTGTAACTCGCTGTGGCC
TTCGAACTTCACGATCGACTATGTGCGCGTCTACCAGGGCAACCCGAACCGGTACACGTCGGTGGGGTGCAACCCTCAGGCCTACCCGACAACCGAGTGG
ATCTACGCTCACCCTGTCGACTATGGCCTCCCGTGGTACGTCTTGCTGCGCGTTGACATCGGCCTCCTCCAGCTGTTCGCGGTGATCAATGCCCTGGTGG
GCCTCTTCATGGCTTTCCGTGGCACGTCCCACCCGAAGATGGCGTCGATCTACGCCAGCTCGTTGTGGCTCACAGCTTCATTCTATGGGGCCCTGAGTGC
GGCCGCCCCTGACGATCTCGCTTGGATCCAGACCGCGCTTGCTTGCCTTTGTGGCTTGGTTCTGGGCGGCGTCTGCTGCTTGGTGTACCCGGTTTCGCTG
GGCGCGATGCTTGGTTTGTATGGCGGTGTGATGGTCAGCCAATTTGTGCCTCTGCTCTCTACGCGCGTGATCACTGCCGTTCTTGTGGGTGTGGGTATCA
CGCTGGGAGCTGCACCGCAAGTCGACACCAAGCACGTCGTGATCTTGTCGACTTCGTTGCTCGGCAGTTTGGCGTTCTTGTTGTCGGTGTCGCTTTGGGT
GAGCGAGGGCGATATTGCTGCGAACGCGTGGGATCTGGCAGGCTTCGTCTTTAACGGCAACAGCGACGACCACGTCGGCTTCTGCTCGGAGCACTGTTTG
GCAATGTACGTGCTGCTTCTCGTGCTGAGTGCGACTACCACCGCTTTCGGATACTACCGCATGCGTGGAGTGACGCTGCGCAACAACACGATCAGTGCTC
GCAAGGCTAAATTCCCGCCGGTTTCAGCTAGCTCCGACGCTCGGTCTTGGAGACCTGATGATGATGATGTGTCGGCGTCGGATAAGAACATGGTGAACTT
CTTTTCCCCCACGAAGCTGCCGCACAACATGCAACAGTTCAGCACTATCTTCCGCATCGCTGTGAACGTGCAGCGCTGCTTTGGTTTCCAGCTGGATAAC
TTCCGCAACCAGACGGAGCACATCGTGGTGCTCCTTACGAACAACACGCGTAAGGGTGGAAACCCGTACCGAAAGCTTCATGAATTGGTGTTCTCCAACT
ACAACAAGTGGTGCTCGAAGCTGGAGATCCAGCCGCTGAATTGGAGTGAGCAGCGGGCCCCTCAAGGTGGCCTTACCAGCGTGGACGAGATCTCAGTGGA
CTTGTGTCTCTTCTTCTTCATCTGGGGTGAGGCTAGTAACCTTCGTCACTCTCCGGAGTTCCTGTGTTTCTTGTTCCACAAGATGAAGGAGGAATTCCCG
TCGATCCGTCACTCTGAACGCGAAGCTGGACACTTCCTCGACACGGTGGTGACGCCTGTGTATGGTTTGCTGAGAGCTGAAATGACGTCCAAGCATGACC
ACGAGGATCGCCACAACTACGACGACTTCAACGAGTTCTTCTGGTCGAAGACATGCCTGAAATTTGACTACAAACACGAGGAGGTTCTCGACACCACGTC
ACCGAGCCCTGCTTTGATCTATCAGCAGAAGAAGAAGCAACGCGAGGGACTGGGTGGCTTCAGCAGCCGTGGTGGTCTCAATGGCGGCGCCAAGAGCAAC
AACTTCTTCAACAAGCGTAAGAGCATTGCGGAGGGATTCACCGAGTCTGCTAAATCGTTCGTTGAGAAGCGGACGTGGCTCCTCCCGCTGCGCGCCTTCA
ACCGTATCTTCAACTTCCACGTGATCTCGTTCCACTTCTTGGCGGTTCTGGCGTTCGCCAACGAGCAAGAGATGAATTTCCAGGACTCGTGCAAGATCAT
CTCGAGCACGCTGATCACACCCTTCTTGCTGGACATTCTGCGCGACGGCCTCGATATCTTCGCAGTGTATCATGTGCAACAGAAGTCGTTCTCGACGGCG
CGTAACGTCATGCGTGTGCTCTTACACCTGGTGCTCGTGGTGGTATCGACGATGCTGTATTGGTACGCCTGGGCGTATGGCGGTTTGTGGTGGCAGTCGT
ACTACACGATTGTCGTGCTTTTCCACGTGCCAGGCCTGATCAACTGCGTCATGCAGGTGATGCCTGGTCTCACGAACTGGACGCGGCGTACTAAGTTTGC
TCCAGTTGCCTTCATTCGTGATATCGTGAGCCCGATGAACCGTCTGTACGTGGGCGACAACGTGTTGGACCCTGAGTCTATGAGCCTCGGCTACCAGTTC
TTCTGGGCTTCGCAGCTGGCTTGGAAGCTGTACTTCAGCTACAAGTTTGAGATTTATCCGCTCGTGGTGCCCACGTTCTTGTTGTTCGCTGATCACGTGG
AGAACAACGTGAGCATGATCACGACGGTGTTCCTCATCTTTTTGAACTGGATGCCGTTCTTCTTGGTCTTCTGCGTGGATATCACCATTTGGAACTCGAT
CTGGATGGCCTTCACGGGTACCTTTGTTGGCTTTTCATCGCACATCGGTGAGATTCGCAACTTCAGCCGAGTTCGCACAGCATTCAGCCGCGCTGTGGAT
GCGTTTAACGCCAAGGTGATCGCCCGAAACTCGAAGACCGGCCTTCAGATATCAGAGAGCACTGGCATGTCGTATGGATCGACTTCTCTTGGGCACGAGG
TGCTGGATCGTGTCGCCGGTGGCGCGGATCCGACGTCGCGAATCCTTTCCCAGCGGCGCACCTCTGTGCATGATGACGAGACTCCACTGCTGTCTTTCTC
GCGCCGTAAACAGACACCTATGGAGCGACAGGCTGCGCGTCGGCGCAAATGGTTCTCCTTCTCTGTGGCGTGGGATACAATCATCGACAGCATGCGCGCA
GATGACTTGATCTCGAACAAGGAGAAGGCACTGCTCCAGTTCCACCGCCTTGATGGTTACCAGCGCGAGATCTATCTGCCGCAGTTCCAGTTGGCTGGTT
GCTTCGAGAACTTTACGTCAACGATTCTGGACATCTACTCGTCCAATGATGGCAAGGTGTCGGAGCGTGTTCTGCAGGACAAGTTGCTGGAAATTCTCAG
CGAAAGCCCGATGGTAGAAGAATCCGTGGAAGAGATCTGGGAGCTGGCGAACTGGGTGCTCGTTAATGTGCTTGGTCCGTGCCACACGAACGATGTGAAG
TACATTACCAGTGTGCTGAACTCGTGGGCTGCACGAGGTGTGTTCCGTGCGCTTAACCTGCAAAAGATTGCCCCTTGCGGTCGCGCTTTGGCTGGCCTGG
TGTCGCTCCTGAAGTCCAACGTCCGTGCCTGGAAGAACAATGCCAAGGTTATCCCTGTGCGCAAGGATCCGTCCGATTACGCGTCGTACGAGTTCCCTCA
GCAGTCAAGCTCATACCGCCCCGCATCGACTGGTCTTACGAAGTCTGCTAGTACGACGGGTCTGTCGTCCCTTGGGTTGGAGCCTCCTCGTCGCAGCCGT
GGTTCTGGTGTTGCG