Description :
From Genome Similarity Track
Location :
Scaffold_650:4772- 5976
Transcript NameFunction/comments
Phyci_22215hypothetical protein

Sequence
1204 bases(100 bases per row)
GTGGCCACAACCAAGTAGTCGTAACTCAAACGCTTCACCGGGCCCGCGACCATTTCGTCGTCGTTGCCAATAGGCGTGTACTCGACCTCATTGCCAGGCG
TGATGCGCGTCACGATGGCGCGCTCGATCTTGACTAAGGACCGAGCCTCGGCTGGGATCGCATTATCGTACGGCACGAAGAGCTTGTTGGTGTAGGCAGC
ATCCACCACAGCGCGGGGCGTGCCGACTGCGTGGTAGTAGTACTTGCTCTTCTCGAAGACAACCACCTCCGTACCGTCGTTGGGAGTGAGGTTCTTGGCC
AGGGCCTGGGCAGCGGAAATACCCGCGGGGCCGCCACCGACGATGACAATGCGAGGCATGGTGGAGCTTGGCTGAAATTGGAGAATGTTGCACTTGTGGA
GTGCTGAGAAGGTTTGCGAATGAGAGTTTTGACGAGACTCTCGTCAAGTTCGGAGCCAAGCCACTTGAACCAAGTACAAGTAGCTTGGTCGCACAAGTCG
CTGGCAAGAAGCTTTACTAATCACGTTGTGCCCCATACGCAATCGCCAATGCCATAATCGTGAGCGGGGCGGCGATCTGCATCTACGCACCTGCCAGCGA
CATAGGTTTACATAGGATACTTGGACATCACCGGATGCGAACGAACATGTACAGCATTGGGCGCGCGCGTCTAGCGGGAGTTCGTCGCCAGGAGGATACG
TGTGGTCGAATTGGCGGCCAAACCTCGTTTCATGAAGGTTTACATGACATGTAAATACATTGTATTCAAGTACTAGCCCAGTACATACCTTACATACTGG
TGTTATACCTGTACACTTACAGAATTGAAAAGACGCCGGCAAACGTGTCCAGGTATTTTTTTCCCCTTTGTATACTCAAATCCAGTGCGCATCCTACATG
TATCGTGGGCATAATCTTCAATCAACTTTTCACAGAAAGTGAGAATGCGTGCGGTGGCTGCTGGCTACAGTAAAATGTGTATGTCGGCGTGAGGTCAGGT
TGGTGCTGGCAATCCTGAGGCCCTGAGTTCTCTAGGAGTAAATGCCCCCGATGCCTGGATTCAACTATTTTGGCAGTACAATACTGGTAACCAGCGAACG
TGGCTGATTGCTTTGATTCAATACAAACCCAAAAATTGAGAACTACGGCATCAGAATATTCCTGATGTCGAAGTTACCGGGAAATAATCTTTGTTTTGCG
AGCG