Description :
From Genome Similarity Track
Location :
Scaffold_602:4772- 5781
Sequence
1009 bases(100 bases per row)
AAATTCATCGGTACCTCCATCTTTTTCGATCAAACTATCATTCTGATATCTGGATTGGCTTTATAACGCAACAAATGATGGATAAATGTTGAGCCTGGGT
ACTTGTCACCGCCGATAGCGACTCCTTCGTAGAAAACGTCTGTCGTTTGTGAGATGATATTATTCAGATCATTGGACATGCCGCCCGATTTCGACACGCA
AGCCATACTTCCAGGCCAATAGAACTTGGAATGGACTATCTGGTCAGGCATTCCACCAGTGTTCTCGATGCGTAAGCGTCCCGGTTGCATCCCTCTCGCA
TTGACTGATCCAATGATATCCACATCCTTCTTAATTTCTTTCTTCTAAACAATCTCGTTTGAGCTTCAGGGACTCCTTCGGCAATGATGGCATGCGTTTT
GATGGTTTCTGCGTGCTGAAAAGATGAGCATCATCAAAGATACCGGTATGCTGAGTACTGTACATCGATTTGATTGTGGTTACAAGAGGCACAAACTGTA
TGCGCATTTTCGAAAAAATGTGATGTGCTTCAACGCTTTAAAAATTGATTTAATATGGACATACGCAGCAAGATTCTCTCTACACTGCACCCCAGACTTT
TATTCGAAAATGTGATCTGGATAAAACGCGATGAGAACGGCTGTTTGACTCTGAACTCTTTCGACGTTCTGAAGTATCATATCATACGAACTGTGCAAAT
CAAAGCACCATACCTATGTTTTTTTCCGACGGGAGGAGCGACTGAAACGACATTCACATCAATCCCCAATCTCTGGTATGCGCTGTACTTCTGATTTGAC
AAGAGTTCTCGGGTCATCAGACTAGCCAATATCTTTTTTCTCGGAAACGTTACCGGATACATCTTCTTGTTCAGTCTCCGCATGCGCAAGTTCGTACAAT
TTAGCCAGTGTCCGTAATTTGCAGCAGTATCGGGGGCATGTAGTGTCCTCTTCCTGAGTGCGAGATTTTCTAAGAGTATTCGCAATGAGACATCCTGAAA
GTAGATTAC