Description :
From Genome Similarity Track
Location :
Scaffold_1077:4771- 14183
Transcript NameFunction/comments
Phypl_g12287conserved hypothetical protein
Phypl_g12288protein kinase, putative

Sequence
9412 bases(100 bases per row)
GCAAAAGGGCAGCCTCCTGTTGGACTAGCCTCCTCCCGACGATACTACGCGCCGCCTACAGCCAACGCTGAAGCCAAGTACGTTGTGAACCtcctggcgg
cggcgacaacgtcgtttgagcagctcgtgcgtcGCCGACGTTTGGGGTGCCAGCCATCCCTGCACATGCCTGTGAACCCCAACACGGCTCATGACAACAG
ATGCAGCGTGTGTCTAAGGAACTTCGGGCTGCTGCGCCCTCAACGGTTCTGCCAGCTCTGCGCACAGCGCGTCTGCCGTGAGTGCTCGCGAAAATTTGAC
GTGGAACCAGTAGCACGCAGAGTGCGTCGCGATCGCATTTGCTTCGCATGCGTGGCCAACGTGGACGCCAGCGTGTTCCAACACGACAACCCGCTCCTGA
ATACGTCGCTCCCTAGAGCCTCGACGGCAGCCACGGCTGGAACCAGAGTGACCACAGACGACCGACAGGACGAGGTCGATGGCACGAAGATTTCCACCGC
CTTCTACGACATCCTGCTCAAGCCCAATGACACCGCTCGTAAATCACAGTCAACTGGTCAAGCAGCGACTTCGCAGGCTGCGTATGAGGCGCAAATGCAC
CGACTGGACCGCAGTAGCAGCGCAGCGATCGCCTCGGCATCGTTCTCCTCGACACCTGGCCGACAACTGGCCGACGCACTGTTTTCGAGTAATCCGGCGA
CCCGAGCGCGAGCACTCGAGATCGTGCGCCACGTGGTGAAGCAGGTGACGTCCGactcggcgccgacgagctcaacgtcgacatcttcgtcatcctcAGC
GTTCAATTCATCGGTTCCGGTGTTTCACCCGCAGTTCCCGGACCGGAAAATGGTGGACAAGTATCTGGAGGCGCGCTTGCACCTGTCGAGCATCTCGCTC
AGTGGGGACCCTACGGCTgcggacgacagcagcaccatccCCCGGAGTCGATCAAGCTCGCTCTACAGCCTCCAAGAGGTGACagagcgccgacgacgca
gTACAAGCGGCCAgtgctcctcgtccgcagTCAACTTCGACACTCTTAGACCCTCAGTCGTGCCGCGACCAtggacgaccacgacgaacctggagacgga
gctggatctggacgacgacctggacTCGGCAGCGCTGGACTCGATCTGCGAGGTCGCCGCCATCCGCATGCGGTGCTCGATCGCGTACATCGTTGCGCTC
AACGGCGCCCACAGCTTccaagctcagcgagtcGTGGGGTCTTCCGGTGCTCCACGTCCGTGGACGGAAGAGGTGACGGTGTGTCCGTTCCCTCTCGTGG
CAAATGGCAAGCCGTTCGTGATCAAGGACCCGATGCGCGACccccagctgcgccacctgcggCTTGTGCGCGACATCGGCGTGCGGTTTTTCGCCGGGTT
CCCCATCAAGTCGCCCGACGggtccgtcgtcgcctgccTCTGCACGGTGGACGCCAGGGCCCGCGCGAAGACCTCGCTGGAGGACCTCAAGGCCATGCac
gcgctgtccaagctcgCCTCCGACctcttcgaggaggaggtgaaCCCGTACACGCCGCGCAATGGCACCCACGGATGAAccgccacttcaacgtccaGAT
ATTTTACTTATTTCAGTACAATGTACGGCCTCAATACCTCAGGTACTGTATCAGTCCAGTTCTCGCTGTGAAGGGAGCCATGCGGATGCGTCTACTTACG
CGCCTTACGCGCGCGCCGGTGCGCTCGAAGGTGGCGCTGACGtcggcggtgcagcagcagcagcagctgccaACCCCCAAGCCGAAAGAAAAGGCGTACA
GCAATGGGACGGGCTGGGTGGGCCTcgtgacgacggcggcggcattgGGCGTCGCGTTCCTGATGCACCGCGACGCCCCCAGTAGCGACGTCGAGTGTGG
GGCGAGCGGGGACTCTGGGTGGATGAGCTCCAGGCTGGAGCAACGAGGGcactacgcgctgctgaaggagctcggCCGAGGAGGTTCGAAGGACGATTGA
CAAGTGGATGTTTGATGGAGAAGTAGACGTTTACTATTATTTGTTTGTTTCATTGAAGGGTTTTCAATTGTGCGTCTTGCAGTTGACATGAAGACGGACC
AGGTGGGGGAACTTTGAAAGTGTGATTGAGCTCCCTAATAGCTGACCTTCTCGTTCTTAATTGAATTCGTAGATGGTGGCAGCAAAGATTTTTGACCCGA
AGAGCTCTTCGATGGAGACAATTCAAGCGGAGGTGCAGTACTCGCTGCGTGGGGATAGTGGGCGGTAGTTGGGGTTGACTGGTCTTGATGAACGGCTTGT
ATAGATTGATATTCTGCGGCACCTTGGCGCACACAGAAACATTGTGTCGCTGCACGATGTGTTGTATCTCAAGGATGAAACCATCATGCTGACGGATTTG
GTCGAGGGGGGAGAGCTTTTTGACTACATTGTCGATATGGTAGGGATGCATTGTGAAGTGTGCATCCATAGACACCAGTTTGCTGACCTATGCTATCGCC
AATTGTTTATGCTGTCGCTTACAGGGATCAGTATCTGAACAAGATGCAGCTCACTTGCTACATGATGTCTGTCAAGCACTCGACTACGTGCATACTCGCG
GTGTTTGGTGGGTTTCCCCACGCTTAGACGAAGTACGCGGTGTCAAATTTTGACGATTGTTTTTGTATCCGCATTGCCTAGCCACCGCGACCTAAAGCCC
GAGAATGTCTTGCTGTCAGACCGATCTGCCAAGCCAAACGTCAAAGTAGCGGTGAGTAGATGTTTTATTGGGCTACCATGTTGACAGATCACCGATCTTT
GCTTGGTTTGCCGCCCTTTATTTCCAACGTCAGGACTTTGGATTGAGTCGGCGCCAACGACAGGGGGAGCAGATTGTTGAAAAATTCCCGAATGGAACTG
TGTAAGCTTACACTGAACGATTCAACATGCAGGGACGTTTATGGTGACTAatttgtgtgtgtgtgttaAGCGCGTATTGGGCTCCTGAAATCATTACGCG
CCAGCCTCAGGACTTCAGTGTTGATATGTGGGCTTTCGGTGTTCTGGTTGGAAGCGATGAGTGTTTTGGCTCGCTTTATTACTTGTTGATTTACTTAACC
TCTCCTGCTGTCTTGACTCTCCAGGCGTACATCACACTCACAGGCGTGCATCCGTTTGACCCACGAGGTGACAAGTCTGATGCTGAAATTGTGAAGGAGA
TCGCGCACGGAAACTACGACGGTGAGTTTTATAGCGCTTTGGCTGCGTCGGAATGAACTCTTACATATTGTGCGGTGGTTGTACGGGTTCAGTGGAGAAC
AAATGGTACAAGAGTCTATCTGCGGATGCAAAGGATTTTTTGACGCGATTACTCGATTCCGACCCAGGTAATCGATTGACTGCCAaacaagcgctgcagc
attcATGGCTGAGCGGCATCACAACGTCAGCGGAGCCCCTCGACAGCGGCCACACTCAACGGCTGCAATCGTATCAGCGCTTGCAACAACTTCGTGCCAA
CATTTTGGCGGTCGTCAtgggcgtgcagcacgcgaaACTCGGTAAAACTTCTAGTGCTGATGAAAGGCACCTCACGTCCCACCGCACATCAACTGTGAAT
ATGGACATGTTCAAGGAGACGTTCGCTCTCTTCGACAAAGATGAATCTGGCTGCATCGATCGAGATGAACTCAAGGGGATGTTATTGGCGCTGGGACAGC
AGCTTTCAAGGTTTGCTTACGGCGTTATTTGTCGATTGCCAAATATCTGTGCAAACACTGACACATTTTGGTCTTGGTTACAAGTtcggagatcgacgag
atcatgcGGCAAGCAGACACTGACGGTGATGGCAAGATTTCATTCACCGAGTTCGTGAACATGATGAACCAGCGGCTATTCCGTCGGTACGAACACATTA
TCTTAAGTCCACTCGTCCAGGTATAAGACTAACATGTGCTCATAATTGTAGCGGGGATCTGACGTCCGGAGATCTCAAAGCAGCTTTCAATGCACGTTGT
GCTATTCCATATGCAAGCGCTAGCGAGCGTTTTACTGACGTGTTCCTTTGTGCAGACCTTTGATGTGAACCATGACGGAttcatcaccagcagcgagctc
gagcacatCCTTTATGTGCTCGGGAACAAGCACATCAGCAACGAGGAAGCCTGCAAGATCATCCAGGCGGCAGACAAGAACAAGGACGGGAAgatcgact
acgacgagttCTGCGCcttgatgcagcagcagcagcagaaggacaCGAAGAGCTGACGCGCTGTAGCAAAACACGCACAGCACGTagtggcgatgctgga
cgcGAGGTGgaaaatgcagcagcgggtgtAGGAACCGTGGCTGCAGGAAGCACGCTGAGATAATGTAGTACATCAAGCCCCGCAGACGAGCGTGTTCATT
CATGGGTGGAAGAAACCAACAACTTGAAGTTGATCTGGCAGTCGGCTCGAGTACGGAGCAGCGATCGGTGAATCCGGATTTCGGTGACGTGGTGCAGCGG
CGACTTTGCCCCGCAAGTGCAGAGCTTGAGTGACATCGCTCGCGTTTGTCGCCGCAATTCCTGTGCGGACAATTACGAGCTTCAACGGCAGTGCCTGCTA
TCGTGCACAGTTGGTTTCGAGACAACGACCGCGTTCCCAAATGTCGCTGAGCACGTATGGCTAGTCGGAGGCAGTCGGGTCGCCCATGCGGTGCCGCTCG
TGCACTCGATactgcgccgccgccacgcggCCATATGCTTAGCTGTGGCGCTGTGCTAAACCGTGGCGAGGAGAAAACGACAGTTATACTGGGATAGCAG
AATGCTGGGCCAGCCAGATCGGATTAATTCGTTGAAGCTGGTATTACTGAAGCCGGTATTACTGAAGCCGGTATTACCGATGCCTGCGTGGTGGGCTGAC
ATTTCCTGACATGACGTGGACTTCCTGACATGGGCTGGACAGAGCGTTCTTGACCTGGTGGCCCCGTTGGAGGCGGACCCAAAGTCGATTTGAGATGGAA
GATGAGAGGCGCGCTTGGCTCGAGTTTCGGGGCTCGGGCTTGCAACGCGGAGCACCAGCCGCAGCCGATATTGCTGCCCTTGCGAGGCGAAatgcacagc
agcaacagcggcgtGCTCGCCAGCGCGAACTCGCTGGGCGCAGCGACGGAGCCCCGCCTCCGAAAATACTTAAAAGTGGACAATCCTCAGCCGCGCTTAG
TAAGTACTTGCTGTGCTTACTGACGCCCTGGACGTTGGACGACCAGTTCTCCGGAGTTGATCTGTCGCCGCGGGCGTTGCTCAAGCTGTGCAAGGACTGG
AACTCTATTTCAGCTAGTTTTGTGAATAGGCAGAGTTATCGATATCTTCACAACATTCTGCAAAAACGGAATCGCTCATTTCGGAATGAAAAGGTATGCT
CGGAATGGAGAAGTCGGAACGCTGATTTTTGGAACGCCCCGGTACCGCAACCGTCGTCACCCCCGACAGTCAACGGTGACGATTTTAGTGATATTAGAga
gagctcgtcgctcggTCCGGATGAGTTTTACGATTTAACCATTGCTGCGTCAACAAAGAACCGAGCGGTAATCAACGCAGTAAAGGCATCGAAGGAAGAC
TTTTGGGCTCTAATATCTGACGGTCCGGGTCCTTTAATCGAGGTTGGCTCACGACGCGATCCAATTTTTCGCGGTCATTTTCAACGCGGAGTAAGCTTGC
CGGCGGTTGCTCGCTCCATTCACGCTATGAGGCCCGTAGCGGATAATGAGGCTGAAGAGGATCATGACGGTAGTGTGGCAGACGGTAGCGGGCCTAATGA
TGGTCTGCGTGGGTCCGCTGAAGATGAGGCAGATAGGATGCGGTGCTCATCGGATCAGCCTGCTGTTTTCGATCGGATATTTCAAAGCATGAATGGCGAT
CGAGGTCTGCGACAAACCCTCACATTACTCCACGGCGGGGGTGGCACGGGTAAATCAACGCTGATGCGACGGATCGCAGCTACGTTAAAGCGCCATGGTA
TCAAGTCGATCGATACCTGCCCGACCGGCGTCGGTGCATCGCACTTGGAAAAGGGGTGGACTTTTCATTCTGCCTTTAAGACCCTTCGGGGTGTTCTAAG
CCCAAATGATCTGGAGCTCCTGCGACTGACTTTTACCGATCGGGTTTGGCTAATTGTTGTGGACAAAGTATCGATGCTTTGTTCAAAATTTCTGGTTCTA
CTAGATGCCCGCCTGAGGGCCATTTACAGAAACAATCTCCCGTTTGACGGCCGTTCCGTTGTACTCTCTGGTGATTTCTTACAATTAAAGGTAACATCTG
GAACGGCGCTATGCAAGATGTTTTACGCTGACTCGAGATCTAGTCTCCACGTAAGTGCTCGGGCGTTGTTTCGACAATTTCAATCATTTTTCTTGGAGCA
CCAACACCGAGCTGCAGGGTGCCCAATTCAGCAAGCCAATTTAGATGCGTGTAGATCGCTTCCTGATTTCAACCCGGTTGGTTCCCGCTGGACAGCTAGT
GAGAGGAAAGCGTTTCGGCCGATAATAAGTCAGGTCGTGGAGAGTATCACTTCGGAACTCGATGCAGACACACTTTCTCGTGACCCTTCGTGGCTCGATG
ACATGACTATACTAGTAACAAGCAACTTTGACAAGGCCGTCTTGACTAGCTGTACAGCGCGTCCTTATGCCAAAcggaaaaaaaaacttgcAATTATTTC
GCTGGAAGCGGGAACTAAAAAAGGAGATTTCGCCCGAGCTGAAGGCTTTGCTGTACGACGAAGACTCTAACCAGGAGCATTTCGCGTACTTCATGGTGGG
GGCACCGGCCCAGGTTTTAGGCAACAACAACGGGAACGTCAGTTTGGGTGTTGCAAACGGGACGCCCTGCAAACTCCATTCTTTAGCGTGGCAAGACGAG
ACGAAGCATGCGCTGGTGCTTGACGCTGTCGAAAAGGCACGAGTTAACGGTGCAGACATTGTTGATCTGCCCTTTCCCCCCGACTTTATAAACGTGCAAC
TGGTTAATCCAAATGGTGACTTGCTTACTGGTGAGGAGTGGCCCGACGAAAACAATTTGGAGAGAGATCGGGTGTTGCAGGTTGACGGCGGGTCCTACAA
GAGGAGCATCATTATTCCGATCGGCATCAAGAAAAACACGAAGCAGAAATCGACTGTTATGCTAGGGTCTGGAGTGCTGGTAACGCCCGTCAAACTTGAG
TACGTTACCCACGCGGTTGACCTCGCTCAAGTAATGACAGTGTGGAAAGCCCAAGGGGCCACGCTTAAACGCGTTGTGCTTAATCTTGAGCCTCTGcgag
caacagcaccaaATTGGGGCTTCGAACATATCTACGTGGGTATGTATGGGTCCCTGCGGTCGATAATCTACGGTGCATGCCCCTATCAGCATCGTTTAGG
GCAAACAAGCTTCGTGACCTTCGGCCAGATATTTATACGACGCGATGGAAGCTCGACAATAGGAGGGGCCCATGATGCAAGGGTGAGTTGGTCCCGGCGT
GAAAGGTTCATAAATGAACCTAAATGCTTCGTGATATCAAATGGCGATTGCGCTGCGCTAAGTTATTTTTTCTCTCGCTGTTCAAGCAATTGAGGCACTT
GCACGATTCTAGGCGGCAGGCACGCTCATAATCGAAAGCGATTTCTTCACCAAGCTATATCGCTCGGCGCTACAATCAGGATTTGGTATGTACCGGCATT
CTTATTTCCCACGGTTGGGAATACGCAACGAGTGCCTTTTAGAAAAGGGAATTGCTCGCTTGGGGAGCGTGGTTAGGCGGCGTTTTGCAGGTCGTCCTCC
AGAGTGTGCCGGCCGCCAGTTTACCCTCGGGCTAATGGAGAACACGCCCCTTCCCATATGTTTGGTCGGGTTCAGCTGCATCAATCGATCAGTTATGTAG
CGGATTTTGCATCATCAGGGATTGTGGCCCTCGCTCTAAGAGATTGCTGGCGATTGAAGGTTGACCGCGCCGTTGGAGGGACCTCTCCGTCGCCTCAACC
TTGAGGTGATGGAGAATACGCTCTATTTGATGGGTTTAGGCGGGTTCCTGTGTATCAATCAGGGGTTTCCATCGTCTGGGACTGTAGATCAGACTCGTTC
CATTTCGaaacttcttcttggcgtcgcaCAGGTGCTTGATGGCAGTACAAAACTCAAATCGAGGTAGAAAAACCACGTATTTGGTACGGCTTTCTCTTTC
TAACGACATATGCGCAGGCTCTAGCGACGCGCCTCTGCCGATTTTGCTGTCGGTGCATGTCGTCTGCGGTTGCGACGACCGTCTTGCCGACCTGGATCAC
GTTTGGTCACTTGTCAGCTCGTGTCTCGATTTCTCGGGTTGCTGGACACCCGAAACGGCTAGAGAAAACATATTACCacaccttctccaccgctTGTCGA
GGCGGGCTGCAGGCTCGGCTTACGTTGATGCAATGTGTGACAGTTGCCACGCTTTTGCTGCGTGTAATGGACTTGTCTCGCAAATGGCGATACTCGATGC
CTTGTTCCCGGACCTGACTATCAGTGAAGCGGTctcggctgcagcgagcagtgGTGACGCGCATGTGTTGGAGTGGCTCTATTCTCGACGTGGGCGTGTT
TGCTGGAGACCTGATATTGTAAAGCTTGCTGTGTCGAGTGGGTCACTACCAGCAGTCCGGTTTCTTTTCAACCGCTTCCCCCTACCAGTGTTGGAGACCC
GTGTGAAGTTTTGCAAATTTCGGCGGCTCGTGGCTACAACAGGATAACACGGCTACTTTGGAGATACTTTACGGAAATGGAACCTGGTCAAGCAGAGTTG
AACACTATTGTGTCTAGCTCCCCTCTTCAGCTGGCCAGGTGGATGGTTAGGAACGCTCATGGTGTAGTACCCGTTATTTCACTTGACGCGGTGGTCCAGC
GTGGAGATTTGGGGTACGTACAATGGACTCACAACTTTGACGCAGTCGCCACTACTGCAGCCATGGACTGGACTGCAGCCCATGGCTATTTTGACATAGT
GGTGTGGCTTCATCTGAATCGGCGTGAGGGGTGCACATCTGCAGCAATGGACGGAGCAGCGGCGAATGGACACTTTGGGGTTGTTCGCTGGTTTAATTCA
ACTCGGTTGGAAGGTTGCACTAGCCAGGCCTTTTTCCTGGCGGCCATTGGAGGGCACCTTGCTATTGCTCAGTGGCTAGTTTTGCACAGGACCGAGGGGT
TTCCACTCAATACATTTGACCATGTCTGCGCAAACGGACACCTCGCAACTGCTCAGTGGCTGCACACCAACCATATTGGTGGTGGTAGCGTCGACGTCAT
GGATTGGGCGGCAGCGCGGAACCACCTCCACATTTTACAATGGCTCCATCACGCGCGTATCGAAGGTTGCACCGTTCTCGCCATgaatgctgctgcgtgt
CATGGGAACTTT