Description :
From Genome Similarity Track
Location :
Scaffold_4:47705- 49533
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_4-snap-gene-0.62Protein kinase
Pytap_DAOMBR444maker-pag1_scaffold_4-snap-gene-0.63Protein kinase

Sequence
1828 bases(100 bases per row)
GCATCAGAGTTTGGAACTCATTGAAATCGATCTTGCCATCGCCGTTGGCATCGACGGTGTCAATGATTTGTTTTGCCTCGGTTAGCGTGATAGCCTTGTT
CCCTAGAACGAGCAAGACATGCTCGAGCTCGTCTCCATTGATAAAACCGTCCCCATTCCTGTCGAAGAGCTGGCAGTCGGATGGACATCAGTCAGCTCAA
TGCACGGAGTCGCTCCACATGCATACAGCTAAGCTTACATCAAACGCTGCATGAAGATCCGCATCCGTAATCTCTCCCCTATCAACGGAAAGTGATGACT
TCAGTTTGCCATAGCATACAACATGAACAGTTTACCGTTTGAATAGGCGCTGATTCATCATGGCCACGAACTCCATAAAGGAGATCTTTCCATCGCCATC
CAGGTCGGCCTGCTTCATAATGGCGTCAACTTCAGACCTTTGTGCACACAAAAGCGTGAGATTGAACCAAAATCAAATTTCAGACGCCTCTCACTTGGAG
ATATGTTGCCCGAGTGCCGTCATGACACTTGCGAGCTCGCTCTGGTCAATGTCCCCAGACTCGTCCTTATCAAACAGTGAGAAGGCTTCTCTGAACATGT
CCATGTTGACAGTTGTTGTTCGTTGCGCATGCGTCTTGATATTGCCTGAGGCTCCCGCCGTGTCACGACTAGCAGAAGCGCTCCCTTCAAATTTCACGTG
TTGCACGCCCATGATGACCGTCAGGATATTCGCTCGAAGCTTCTGCAAGCGTTGATACGCTTCAAGTCGCTGCACATGTCCTTCACCCAGAGGTGTGGTC
GCAGGCGTTTGCCCTCTCAGCCACGGGTGTGCGAGAGCCTGCTTCGCCGTCAGGCGAGTCGCTGGATTCGGATCCAAAaGCTTGGaCAAAAaTTCCTTtG
CATCGGGTGAGAGCTGTTTGTACCATTCATTGGAGACGTCGTAGGTACCCCGCGCAACTTGCGTGATAATCTCTGCATCAGATCGGTCACCACGGGGATC
AAACGGGTGGACGCCTGTCAGTGCAATATAGGTCTAGCCAGACGATTAGGGACAATGAGCATGATCCGACCcAGGCAGTAGCCTTACCAGGACTCCGAAC
GCCCACATATCAACACCGAAGTCTTGTGGTTGACGCTTGATGATCTCAGGGGCCCAATAcGCCCTGGAAGGCAAAGTGTAAAGGTCACTTGCCTGCGACT
AAGAGCACAAGCGTCTGAACTACAACTTACACCGTGCCGCTGGGgTGGGTGACGATCACTTTCTCGTCTGATCGAAGTCGCCTACTGAGACCAAaGTCCT
GTTCGAACATAACTATGAGCATGACTAACTGTTTTGTAGTGTCTCTTTGGcGTGTGTTCTCACTGCTAGCTTGAGGTCGGCGTCAGCTGAGCGATCGGTC
AAGAGCACATTCTCTGGTTTGAGATCACGATGGCTGCCAGTAGTGTGAGTACGGTAATCCCACAGCATTCTTTCAGCCCAAAAACTGTAGATCTCACCAT
ACGCCATGCGAGTGGACGTAGTCAAGCCCCTGGCAAACGTCATGAAGTAGGCGACTGGCATCTCTCTCTGAAATAGAGCCCATGTCGACGATATAGTCGA
AGAGCTCACCGCCTTCGACTAGGTCTGTGAGCATGATtGTCTCGTTGTTAAGGTACAGGACATCATGTAGCCCAACGATATTGCGGTGCCTTCCAAGAAG
CTTCAGAGTTTCAATCTGAAATACACACTGTAAGACACCGAGATGTGCTTCAGTACACAGCGTTGCCATACCTCATCCTTGATATCCTGCATGGAGCAGT
ACTTCGGATCGAAGATCTTTGCAGCTAG