Description :
From Genome Similarity Track
Location :
Scaffold_140:47705- 65803
Sequence
18098 bases(100 bases per row)
CACAGCCCTCAGCTAAACGGTGTATCTCTGGAAAACCTTCAACGCTCTCCCACCCCCCGATGTTGTGGTCGAAATGGACGCGTCGGATGTCGGGCTGTGT
GCGCTTGACGTATTGGGCGAAGACTGCGCTCACCTACGCATTTACCCCATCCCGAGCTATCGCTGATAGCGGAATTTCAAATTGGGAGCCGGCCAACGGG
CTTTGTGACATCAATTTCCGCGATCTCCTTCTCGGAGGCCGTCTCCCGATGCCCCGCTTGAGAAGAACGATGGCCCGCGGAGCAGGCCCCATTCGGCAAC
GGACCGCGGGACAGTGACACCTACCGGATCCGCAAATTTTCCCCCGCTTGGCGCTAGTGATAAAAAACCGGGCTNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGTGGATCCAGGGGCGAACGAGCCG
CGGAAGTGGATCGATTACGTCAGGAGATCTGGGAAGCCGACATCTGCTGATTGGTAAAGGTGCCCGAGGAAGTGTCGGAAGCGCCTGTCGCCGGCTGGTC
CACTGGCGAGTCAGGATCCGTGAGGCGATTACCTTGAGCCCGATCTGACGATAACCCCACTGGCTTATTGCCGGATCTGGCTCGATCCCCGGGTCTTCGC
CCGCGCTTCCAACATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGGGGTTCGGACGACGTGTCGGACCCATCTTCCGCCGCGGATTCGTAGTTCGAG
GACGCAGCTTGGCTGATCCTCGGCGACGACACTGAATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGTAAAGAGGTCCGGCGTCGCGG
ATACTATGAGATCCAAGTCTAGCTTGAAGATGTCCTCTGCGTCGAACACACCGGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCCTTGACTGT
CACCAACTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGATTCAGGATCTGTATGACAGGATCTTGATGCAGG
AAGTCGCGTAAAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATTCAGCTTGGTCTTCTTCCGACTCTAGAGCTTGCA
TCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCGTTCTCGTTTCTTCGATTAGCGGGGTTGGGTTTAGGTACGGTGCTGGCTTAACCGATCAATCTGC
AAATTCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTTGCGGATCTTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGAGGAGGATA
GAGAGGTTTCTCTTCTAGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGTGGC
TTCGTCGATCCGACCTCCGACGACGCCTCTTCCCCTGGTTCAATCTTCACTTGAGCATCTTCTTGGGACTTACGGTGAAATCCCGAGTCACCAAAAGATC
CGGGCACGCGCACCATTGTGGTGTAGCGAGATAAGCAAAATCTGCGAGATTGCTGGATCCAACTTACCAACCGCGCCCAGACACCGACAAACGGAGGGGG
GCCCCCGATGATCCGTGATCTGCTGAACGTTCCTCACCTTGTGGCCCCGTCGGTAGGGCGGGATCTTGCTCTCTCGGTAACTTCCGAAGAGCTCAAGTGG
TGAAGCTTGGGCGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGTAGTGATAAGATCTTCACTCTGCGTCCGTGATTGGTTCTGGATCTTAAGCGAATG
TTCGAGTTGGTGGATCCAGGGCCTAGATCGTGTAACGAGCCGTAGGGTTGCCTTGCGGGTGTGTCCCTCGTCTTTGCGTTTCCTTGGCGTCGTACTTCCC
GCCTCCTGTGACGGGATCTTGAGAGTTGAGAACCTCTAGAGTGTAACCGACCAAGTAGTAAATTCGGTTAACCTGTCGGATCTGCACGTGTAAGGAAAAG
CTCACTAGGTTGTAGGATCTGGCCAATGTATTATCCAGTTATCACTACCAACACTAGATTCGCAATTCCCAACCTTCCCCGAGCTCGTACGGCCAATGAA
GTTCCGATTCTTGAGGGCAGGAAGGCACTTGTGTGATACCGTGCAAATTGGGTTCTGTATTGATACTTAAGCCTATACCTGCCTGGATTTCTACCTTCTA
TGTCCTTTACTTGTTAAATCCCTTACCAGGCTCGGCTGCGTGTCCTTTCTTTCCTTGACCCACCGTCCCAGCTGTATTATCCTCAGATCCACCGGATCCA
TGGCGTAATCATTATGGTCACCCTATTATGGGTACACTCATCCGGATCCAGGTTGCTTGGATCCACTTCCTTGTAAGTGTACACTCGTTATGGATCTGAG
CTCTCCAATACTCCAACATCGTCTTGCGACCGTCTGTGATCTCCATTGTCCCACGTAAGTTCGAGATCCACTGTATCCATCATTCCTGTATCCTGGATCC
AGGGTCCCTCTATGCGGGATCCTCACCTCCATGGACGGAAGTATGGGATCCGGGACATCTCGCGGTGGATATTGACTTCTCGTTAGTCGTGGATACGAGA
TCCACCTTCCGATGACACCTACCATCATCCCTTCATAGGATCCACGCTCGATCCACCCGTACATAGTATTTCCCATATCCACCTAAGTGGATCCAGGTAA
GGGTGGATCCGAGATAAGTCTTGGTGGATCTTGCCTTCCCGTACATCACTCATACCAAATCCATCGTCGTTTCATACGGGGTGCTGCTCGTCATGGCTAA
TCCACCAGAGGCAACTTGCATCCGCGCCGGACGATCCAAATTATCTCTAATCACTTGAAATTGTCACTGATTCGGGATAGTGACCCCGCGTTAGGCTCAT
TCTCTTATTTCTGAGAAAGCACTTCATTACAACGCCTTTATCATCGTACAATCTTTTTCAAGAAGCTTCTATTATCTGAACGGCTTTCTGTTCGAGAAAA
CAGCGAATGTAATTGTTTGACGAGAGCTCAGCATTATGCCAGGAGCTTCCTTGGCTGTATTCACTTCCAGCTATTATCTTCGACATCGCTCACCATACAC
GAGTCTGTTTTGCGCAAATTAGCAGCTTCAACAACCATATTAGGACGCGAGAGCTATACTACCCATCTACGTTTACGATCCGCTGAAGGTGTCCACAGAG
TCAGCCTAAGCATGAGCCTAGCTTGAAGAGACCACACAGGAGCACCGATACGGATGTTATTGGACTTCGACTTAGTTTAAGAGAAGCCTGGGAAAGACAG
CGTCTCGCAACAAGAGTGATTGTCAAGTAGCAAACCATTTCCCATATAATCGGGATAGGCGCTGTGCCTACAGTGCACTCGCTCTAACTACCTTACTTCG
ACTGCTTGGTTGCTGCTTATCAGAAACGGATGAGCCACCGCCGTTACGGAGGTCTACGTTACTAGAAACCACGATTGGTGTCGTGTGTTCGATCTAACTA
TGCTGACATCTGTGTAGCAATAGGCCCTGTCATCATCAGTGTGGATGAATGGCATTTACACCATAATCCACATTTCCGTTGTCAATATCAGCTCCGACGG
CTACTCGTTAACGACTGCTCTGAGTGGATCGCGGTCGTTCGACATGTCGGTCGCAAGAGCCTTGTCAAATATGCGTTGGTCCAACAAGGTTCAGAAGTGC
CACTCCATTTTCTTTGTGCCATTTCTTGTACGAATGCCCATCAACTAGCGCAAATCTCGCGTGAAGCTGGTCCAGGCGGTGCACCCCCTGTATATGCTGG
TTGTATTGTAAAATTCAGGCTGGTACTGGAAACGGTTGTTCGTCACCACCAACGCGACGAGTTGTTGTAGCTGACGGATCGACGCTAATTACCTTGGTTA
AGATGTTTCTATCACACCATGAGGCAGCAAGTATTTCTGCACTGGCGTGTTGATTATCACCCCTCCCCCCCCCCCCCGCGGGTGGATTTATCTTTCTGAA
TAACTCTGTGTTTGGGAAATAGCGGCTGGTGCTACCGACAATGCCACGCCCATACAGCCCCTTTAAGCAAAGCTCCAGGATCATTTAAACACTCGTGTAG
TAGCTGTCCATGCTAATAATCTTTCGTGAATGGAAAAGTGTCTCACCACTTCTAGCACAAGATTTCACACTTGTTTGACCTGATCAAAATCCTTCCTCCG
CAGAGTTTGAACTTCTTCTGGGCTCATCACGCTCAGAAGTCGATCAGCTATGCCACTGTTATTGCAATACAGTCGACAGTTTAGAGGTATTCAGGTTGTG
GAGCAGCACACCACATACATGCGAAAATTGTACTCTCCCCCAGGCTTCTGGGGATTGAGTACGATAAGATAACGACCATAGTGGGATCGACACGCAACGC
GTGCCTCGTCTAAAGAATGATATTGACCATTATTGATATAGTGTCCACCAGTGCACTTCAACAGGCTCGGTAGCTGCCGGATTTAGCAGCAGGATCACGC
GTCTCCGAGCTCTCCGTGTCTGCGCAAAAGCTGAAACAGCCACCCAGCAGCTTAAATTGGTTAAGGCTCATCGCGATATCCTGGATAGTCGACGTTCCAT
CAGATTCACGTCCTCAGCATGTAATTCAGACCCAGAAATTTATCGAATTCCTCTAACGTGAATGGGTGAGTGATACAGACGCCTTTAAAGCAGCATAGCG
ATTTGTTTTTATAGTAACTTGCTTTCAGAAGTAAATTGGTACGTACGCGAAAGGCCTTGAAGATGTAGAGAGCGCAAATATGTGACGGAACTCAGTGTGT
AAGCATTGTTGTAGCTCCATCAGTGTGCTCATAAAAATTCGTTATTGTGGCCATGCTAATATCCGGCTCGAAGTGCATGCTCTATCGTTACCAAGTAGCT
TGTTTTCTGTAGTCCGTTGGCGTCATCGGAAAAAGATTTCAGTACCTGTTGTTAAATCTGTGACCATGTGGGGCTTTGAAATTCATCCTGTCGCTTTTAG
CTCTTTCCACACTCCTTGAAAGTTGAAAGTCACTTCCTGCCAGCCCCACTGGCGCAAGGCGCCCCAGTGCTGTTGTCCCGGGCTCTCTGACGTGTCCGTC
GAAGATGTAACGGGGCTACACGGTGCGGGGCACGCATGGTACGGTGTACCCGGAGAGGTAAGAAAACGACCCGTATATAAGCTGGAGAGCTAACAATGTC
TCTCAGTGCGTTGGCTAAAAGCCACACGTCATGTATTGGATTAGGTTTTACTAGGCTAGATAGCTAAACAAACATTTAATCCTAGGCGGCTTGGCCACAA
AAAAAGTAAGTAAAACACTTAAAAAATTTATGTAGAAAAGTTATTTCGAGTAACTCTTCAGCCCTGAATTTAGGGCTGTGTAAAGTTCCTTGGGATAAGG
AACTTTGTATTACGGACACTTTAATTCGAACGTCTTTCTCTGACGCTAAAGCTACGGCAGCCTCGCCGCACTTGGTAGCACTTGTAGTCAATCCCGCCCC
TGAGCCGGTTGACTGTATCCTCTGCGAGAGTGAAACACCCGGTGTTCACAAATTTACCCCGGCGCAGCAGGACACGCTTATTATACTCATGTCCTTGCTT
GGCCCGGAGGACATGGTTTACCTTGCATGACAAGGTCCAGAAGCAGCGACCGCCCGGCTGGGGTCGTTCTATCGATACGAGAACGCGCCCTTGGAGCATG
CTCAAGAAAAGATGAGTACCGCAACGGCGACAACATTGGTCACGCGTGTCAGGTCGGGGAGGCCAAATCCGCTCCTCCTGAGCGTGAAGAGCTTAGAAGG
GAGGGACGGAAAAGGCGTCCTTCTTTGGACCCGTATAGTCGAGACGGCCATGGGATCGGCCTTGCTTCAGTCTATGCAGCAACGTGCGGCATTTGCCATT
TCGAAGCTTGAAGGTCGCGCTCGTGAGTAGACATTAACGTGCGATACGTCTGTGGACGTTGCGTTCCCCACTTGGACGCTGTTGAAACAACAGTTGTCGC
GCGTGTTTGTGCAGGCATGCCGTGTTTGGTCGAAGTTTCTCGCCGCCCGACAGGGCAAGAAGAAGTTGCTGGACTATGTCCAAGAGTTGAGGACTCTAAT
CGCCGGAATGGCGGCGGTCCCTCTACCTGAGCTGGTCACAGTGACCGTCGTAATAGAAGGGCTTCGCGTGGGCGTATCCCGAATGGAAGTATTCCGTGCA
CGCCTACCTCTTTCAAGGAGGCAGTGGAGTGGCATTAAATGCCGAGCGCAACTTTAAGTCGGCCCGACCGTGATAACGTGGGGCTTGCGGTCAAGAGCCG
AGGGTTCTCAACTACGCTGGAGATGAAGAAGCAGAGCTTCTTGCAGCGGAGCAACGCGCCGGCATCCGACGATGCTTTGTGCGCAGAAGTACCAAGTATT
TGCGGGCTTATTTCCGCTGCGTAAAAAGCGCGAAGCTCCGGCGAGACAGGCCTCCGGGTCATCACCGGGAAACGGCAACTCCCAGTAGGCGCGGGGTGGC
CTACTGAGGAAGAACTGAGCTCTGGTGTGTCTTGAGGAGGTCAGCTGGGCTCATCCCCCCGAAGGGATCTGGACTCTTATACGTGACGAGTGTGCGCAAG
CTAAGTTTACTGATCGCTCAAGCGAGCGTGAAGGGCTTTGCGAAGCCGTGTAGAGTCTTGATTGACTCGGGAGCCTCGGTTAACTACGCCCGTCGCTCCA
CCCTGGGAGGAAGTCAGCTGTACGCTGAGGCACTGTGTGTACAAACAGGGGATACCATAACTGTCCGTCTCGCGACGGGAACACTTGTGACTATATCAAA
GGTCTCAGCTGGCCTTGGTGTGAAGTTTGCAATCAGAATACAAAAAGAAAATTGACACACTACGAGGTGAGGGAAATTATAAGACACTCCGTCTTACTGG
GCCTCTCTGAAACCACGTTTTGGCTAAGGAAAAATCCTGAATTATAACTGCGGTCGAAGTAGCTTGTAGCCACCAGAAATGACAAAAAGTTCCGTATTTT
TCAACTCATTGTGAGTGTCTGGTGAGCACCGTGAAAGATGCCTTAAATAAGACCCAAGGGCTCTGGTACTACAGAAGTACGGACTCAGGCGTCAACATCT
GAAGCTACAGCACATGTAAGTGTCATTTTTTGCAGAAACATTCTTACAACCTCAGGTTTTCGAAAAATCACAATACAATGCCCACACGCTGGACAGAATG
CAGGGGTGGGAATGACGCTAGCCAACATGAAAACGTGACGACTTCGTTAAAACAAAAACGAAGAATAACGAGCTGTTTGCGCTCCGGACAAAAGTTGCAA
TACGTTTTGAGGATTTAATTTATTACGCGCTCAGCGCATTTCTTTGTGTACGATCCAAAATTTTAGAAAAACCGAGTCGCTGAAACTTGATTTCTTACCT
CGAAGTAGCTCAATACTTCGAATGTCCCACGCAGTTTTTGGACCTAACCGATGAAAACTTTAGTTCTTCTTTTAAAAACGAAATTGGGTTTCAAACGGAA
TGGTTGATACAACATGCACTTTGTATCGATCATTCACAATTATTAGTTTTCTTAGACAAAAATTTCTGGAAAAAATCGATAAATGATGAAAAATCGAAAG
ACAGCAACATCCAGGGTTATTGCATAGCGAAGAAAAAACCATTCCGGTATGTGCTCTTCCTACTTCATATCTGGAAGAGGAAGCAGCTAGCAGACAAGAA
ATACCCGCCTTTCCTTGCCCCTTATCGGTGGATTGCTAAAATAAAATGCATTTGCCCGTTTGACCCCCAAGAAATGTGGAAAACTCACGCAAAAAACTAA
GAGCACCCATCATGCTAGTGCAATTGTAGCAGGTTCAATAAGGTGGCGAGTCATTGGCAGGCTTGGGTGTCTCCACTATTATAAAGGATACGTCAGACGA
CAAGGAGCAGGTCAACAGCTCGTCAGACGCTTCAGTCGTGGGTGTAGTTTCTTCAGTCTTGTGCGGAACGATATTACTTTCGAGTGCTTTTTTTTTAGGA
AATCGAGTGCACCGTTAGTTTTTTGTTCGAAAGGTGTGAAACCGAGTGTCCCTTGTTCAAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNGTCGCCGCGCTACTTTAGGGCCCACCTCCCGCCCCCACCCTTTCAATTTTTTCCGTTTACAGCTCTTCGGGGATTGTTTTTTCACAACTC
GTGGTGACCAATATGGTGCCCCCGGGGGAGAGAATCTTAGTACAGATTCAGCTTATTACCGGAATTTCCTCCCTCCCCGCTCCCTGGTAATACGCAAGGG
AGACTGTCCCTTTTTGTCATAGGTAATTAACTCACATAGGCACCCAGCGAGGTCGCCCCCCATCAACCAGTTTGTAACCGAGGCCTTTTTGGGATAATGT
TCAACCGGTGACACATGGCTACCCCAATTCCACGACTACGCACACCTCGATCTCCGTAACCTCGATCTCCATAGAAAATTCCCCTTGTTCAACTTGAGGG
AATGACCGAGTGCACTGCTGAGGTTTAGGCTTGAGCACGGAAGAAGATGCGTCAAGGCTCTGCCTTCATTAGTTCAGACGTAGCTAATGTAAGCTACATG
TTGCAGCAACGATAAGTAGGCGTTCGTCTACAAAGCGATCCACGAGCTAGGGTTAGTGTGCTTCCATCGCCAACTTCGCTCGTCAGCACGCCAGTCCACA
GTGTAAGAGTTCCTTTCGTTCAAGCGCTTCTCCGTCAACACGATAAGAGCAAATTCAACGCTCGCCGTACGTTCACACGAATCGCATCCCCGCAGTGTCG
ACCGTGACGCCGACGACGATCAGGACTTGGACAGCTAAGACGATCAGGAGTGACAGTTGGCATTGAGCATGTGAGCGTAGGACTGGACTAGCGGAGCTCA
GCGTACCTTGTGTAGGAAGTGAACCAGGATCCAAGGCTCATTCATGTTTTCTTCTCACAAATACATGTATTTTTCTCCTCTTACATCCTGGTGAGCTCTG
CATCCGGCCCCAAGGACAGTGTAGTAAATTCAAACAAGCATGGACCGGACAAGACAAGTATAGAGCCGACGATATCGCCATGTGTTATCTGCACTCGGCA
TTCCGCCATGTCGTGGCAAAAATGTCTGCACTCGGAAACCCCTCAACGTGCACTCGAATACCATCCGCGCCCGTCTTGTGCTGCGACTTGATGATGTTGG
CCTTCGAGAAATGTGATCCCATCTTGACAAATATACCTGACAGCACCGACGCTACAATGAGTGACATTGCCCATACAATGTACCCCGCACCATCGATGAC
GTTGCCCATTACAGCACTTAAGAGACCAGTCGAGAAATACCCAACAGCGTGCATAATACTGGTGGCCCCAGCAGCGATGTCTTGGGGGAGATCCGTGGGC
ACCGTGTAGCTCAGCAGCGTGTAGTTGCCTAGAATAAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN