Description :
From Genome Similarity Track
Location :
Scaffold_1505:4770- 6246
Transcript NameFunction/comments
Phypl_g13574hypothetical protein PHYSODRAFT_330575

Sequence
1476 bases(100 bases per row)
CATAACATTCTCCTTTGGTGGGACGATTCTTATTCTCTTGTGCCAACCTGTCAAAATTAGGCCAGAGAGCAATGGTGGGCTAACCATTTCGGAAGGCACT
TGCAATCTCGACGGCGTAATCCATTGGTCCAAACCCAAGTTGTAAGTGCCATGACAAAACGTTTTTACGCGCTTCTGCATAACCAAAAACAAACGAGTGT
GCAAAAGTAGTATCAGCTTGGACAAATATGAACGACCCCGAATAGAACGAATGCTGGGGTGGATGTGACAACGTGTTGCGTACGCTTGTCGTGTCAAAGG
ATACAACGTCCAATTCAGAAAAGCATTCTTGTATGTTCCATCCGGCATTCCTGCGACATTGTCACCTTGCGCCTTAACTACCAAAGCGAAATTCCGAATG
AGGTTCCTAGTCGTAAAGATGATGCTCCAGGATTTTGCCTTGCTGCCAATCATAGCAGGTTTGCGTCGCTATTCTCCGCTTGTAAGTGCATGTGTTGTTG
TACGTGATTTAATCCATCTATTCATGTGTCATGCGCTATGATTTCCATTTGCATACGCCGCACGCGCTAGTACTCCCCACATGTTCTCGATGAGGTTTAT
GTCCGGGGACTGTGCTGGCCACTCCATCACCGTCACATTCTCCTTCTCAAGGAAGTTTTTGGTGGCTCGAGATGAGTGAATCGAGGCATTATTCTCTTGA
AAAATGCATTCACGACTGTACTATGATCGGTAAACGGCAACAGGTGCTCCGATAAGGTGTAAATATCACATCCGCTATTCTGGGAGCCTCCAGAATAACC
AACTCGAACTTCCCACTGGCGCAAAACGCCCCACACCATCACGCTGCCTCCTCGATTTTGGCTACGTGAGTAAATATGGGTATCGAAGAACAGATTGTGC
CAGTAAAACTGTAAACCACTGGTCTCGTCTAGATTGAATTTTTTTTCATCGGAGAAGACGCCCTGGGGCCACCTTGCAGCGTCCCAGGTCATCGTTTCCT
GCGCCCACGGGAGGCTGTTCTCCTTGTGCCCCTCGGTAAGCACGGGTATCGCCATGCGCATcgtacttgagcagcgggTGCTGTTGGAACAACTCCCGGA
TATGACGAGCACTGAGAGACAGTTGGGGCAGCTTTGAATCTCCGGGGCACTCAATTTTCCTTCGAGACCTCGCGGATCAGCCGCCGCTCAGCCGCAGGTG
TGAGATTTTTCGGCCGACCGGGGAGCTTGACAGTGCCGCAGGCATCTGGGTTAGCGAGGAAGGTGTATATGAGTGGTCTAGAACCCTGTATACACTTTTA
AATAGCCCTCTCGCTCAATCCACACTTGTGGAGAGCAAGCATCTCCTCCTTTTCCTACTCTTTCAATGCTTGGCCTCTAGGTATGAATGATGTCTTCAAA
TCTACTCACTACATAGTGCATGCTACATGGATAGATGCGTTAATCATGTACAACAACATTTGCACTTGCAAGCGGA