Description :
From Genome Similarity Track
Location :
Scaffold_1517:477- 4414
Sequence
3937 bases(100 bases per row)
AGATCTACCAACGTCTAATCGATAACGCCCTCTATGGATTCACCCGAATACCGGAACCCAAAAGGGGTGGATCCGGGGAAGATCATACGGAAGTAGATCC
ATTTGAGGCAGGAGAGCCAGGGAATCCTGAAACCCCGTCCGTGTTAGGACGCAGATCTTACATCGACGACATTCTAATCCCGGCGAAATCGTGGGATCAG
TTGTGCGAAAGAGTGACATCCCTACTGGAGGCGTGTACTAAGTGGAATCTCTCTATCAGTGTGGTAAAGAGCTATTGGGGGATGCGCAAGGTGGATTACT
TAGGCCATCGAGTTTCCAAGGAGGGATTGGAGGCGAATCCTAAGGACCTGTCTTCATTAGCCGATGTGTCCTTCCCCCAGTCGTTACGGGCGATGCAATC
CGTCTTGGGCAGTTTGAACTACTACAGTCGGTTCATCGAGGATTACGACCTGTTTGCCGCGGTATTGTATGAATTGAGAGAGGTAGATTTTGCTGCGATG
ACCACTCCAGCTGTCCGGATCAAAATCCAACAAGCTCTGGCCCGGGAGATGTCGGATCCACGAAGGGGTCCAAGTGGTACGACGCCAGAAGAGGACCTAA
AACAGGAGCTGGATCCACCCCGGGACCAACGGAGAGAGGATCCAGTCTGGATAGAGACGACGGATCAGAACATGGAAAAGGCAGAATCTCGGTGGATCCG
AGCTCAACACGCATTCGTGGAACTGAGGAACAGGATCACGACCACGCCTATCCTCCGTCATTTCGATCCGGAACGTCAACCTACGGTGATAGTTTATGCC
AGTGACTGGGCAATCTCAGCAGCTCTGGTACAAGAACATGAGGGGATCTGTCATCCAGTCACCTTCGTCAGCCGGACACTGAAGCCGAATGAACTGAACT
ACGGAGCGGTGGAGAAAGAGATACTCGCGGTCCTGCGCGTGTTGGATCTGAATTACAGCCTGCTAGTGGGAAGATCCATCCGGATCCTGACTCGACACTC
TACGCTAGCCTGGCTGTTCAAGTCGGCCGGGTTGCAAGGACGTTTGGGACAGTGGGCAGCTTTACTCTCGCCTTGTACACTGGAGATTGTGAGATGTTCG
AAAGGGGAAGACGAGATCCTGGGAGTCTTGGCCACGAGCATTACACCTCGAGCTAAGATGGATGAGGCGCTGACTAGGATCGCTCCTAAGAAAGAGCCCA
AACGCCGGACCCAGATCCCGATCCCGACGGTACAGGTGGATAAGGATCTGTACGTCCTGAGTTTCGATGGATCCGCTCGCGTACGACGCGGAGGACATAC
AGACGCGGAGGGCATACAGCACAATACTGTGGAGACTGCCCGGATGGGAAGTTGTACGGGCCAGATCCACTTATGCGGAAGGCCTCACCGTCAACGAAGC
AGAGTATAACGGGCTACTGCTGGGTTTGGATCTACTAAAGGGACAAGATCCGAAAAGGCTGGTGATTTGTGGGGATTCAAATTTGGTGATCAGACAGGTG
CGAGGTGAGATTGACTGCAAGGCCCCGGCCCTAACACTGTTACGGCAGAAAGTGATGATCCACCTGCGCGGTTGGATGAATCACGAGTTGGTGCATGTCA
AGCAAGATTGGAATGCCAGTGCAGATAGCTTGGCCAGCGCCGCTTTACGGAATTAATGTGGTGTTGAAGTGGAGAGAGAGGCCGAGCATCAGGATCTCGT
TACGTTGAACCGACTAGACGAAGTGGTGGTAGTGGGGTCCGGGAAAAGGACAGTCCAGGTGATGGCCGTCACTAGGTCCAGAGGAAGGATTGGATCCAAC
CCCCAAATTCTCGAGAAAACATTTGTGAAGAGAGTCCGCATCGAGCGGATCCTCAAAGCACAGAACGAGGAAGCGTGGATCCTAGGACTAAAGAAGTTTC
TGATGGGGGATGTACGAGACCTGAGTCGGGAAGATGCCAAATCCTACAGCATTATCGCTACGGATTACGCGGTGGATCTGAATGACTTGCTCTTCTATTG
CCCCCCTACGAAGAGAGTCAACGAGGATCGGGATGGATTGATGAGACTAGTGATGCCGGAAACCTTACAACAGGATGTCCTACACCACTATCACGCTAGC
TTGGAAGGCGGACATCAGGGTATTGGTCGGACCTACCAACGGATCCGGGAATGTTTTCACTGGAGGGGACTATTCAAGAGCGTACAACGGTATGTCGGGG
AATGTGTGGATTGTGAGACAGGCAAGGGCAGGCCCACAATCGAAGGAGAGTCACCTGGGAATATCCAAGCGACTAACCCTTTCCAAATCATAGCCATGGA
TCATATCCCCTCGTTGCCCAAGTCGTTCAAAGGAAACACAGAATTGTTGATTTGGGTGGACCTGTTTACCGGATACGTGGTAGCCAAAGCTAGTGCGTCT
AGAACTGCGCAGACCATTGCTGAATCGTACGAGGAGTGTGTCTTCCGAAGATTTGGAGCTAGCGAGATGATTTGACATGATCGGGAGCCAGGCTTTATGT
CTGATTTCTTTCGAGCATTCAACCGGATCCTGGGGCAGCGACAGCGAGCAACCATGGCATATCGTCCCCAAGCTAACGGGTCGGCCGAGCGCATGGTACA
GACGATCACAGGAGCACTCAAGATGTACGTCCAGGATTTGGATCAGAGGGATTGGGATGAGTACGCAGAACGACTCCCCTTCGCGATGAACACCGCCCAA
GACAGGATCCGGGGTGATACCCCATTTTACTTGGTACATGGGTGGGATCCCAAATCCACCCTAGAAGCGGCCATTCCGGTATGTAGCACCAAGAAGAGAA
ACCGAGATTCAAGGCGATGGCGATACCAAGTCCAGAAATACTACCAGCAAGCTAGATCCCAGGTGAACGAACGACTGCGGAGTGCGATACAGGATCGAGC
GGATCGACACAACGAAGACGCCCGTCCGCATCAAATCCAAGTGGGATCGCAGGTGTGGCTTTATTTGGATCGAGTGAAAGAAGGATACGCCCGCAAATTG
GCCCATCTATGGCATGGACCGTTCCGGGTGAGCGAGAAGATTGGAGAACATGCGGTAAAGCTGGAAACGGCAGGTACCGAATATCGCCTGTTCCCTGTAG
TACACGTATCCAAGCTGAAGTTGGTCAAAGAATACCCGGATCGGCCGCAGATCCGTCTTTCGGTGGATGAATCCGACCGGGTGGATTTCGACGAAGTCCT
CCTACCGGAAGATAGTTGGAATATGGATCTCGAAGACGACGAGTTCGAAGTCGAGAAGATCACCGATATGAGGTCAGGGAAGCGAACTAATACGGACGAA
TTTACCGCGAATTTCTAGTGTATTGGCGTGGATATGACGAACCCAGTTGGGTAGACGAGGCAAATCTGAACTGTGGAGCATTACTCTATGATTTATTGCG
GGATCGTACGAATCGTAACAGATTCGGCGTGATGCAGTCTCATGAAGAAGAGTAGGAAGGGGATCCGCTGATGTGAGTTGGTCATATCGATGGGAGGATG
AAGAAGGACCCACAGGAAGGGTGTGGGCCAGGAGGAGGAGGATCACTGATGTGAGTTGGTCACATCGGAAAGAAAGAGAAGACGAATCCACAGGGGAAGG
GTGGATTAGGAGGAAGGAGTGAATGTTTATGCATAAGAGTGACGTTTTACGTGCGAAGAGTCCCGCTTGATCTCAAGCGCGAGCTTTCAAGGGCCCGAAC
TATACTGACCCAATTGAAACTGGGTCATTGGCGCTAGACCAGGATGAAATTCAGGCGCGGATCCAACCGGATCCGGGATCCCGCCCAGATCCAGGTGTAC
ACTGAAAGGGTGGATCCCGCCCAGATCCAGGTGTACACTGAAAGGGTGGATCCCGCCCAGATCCAGGTGTACACTGAAGGGGTGGATCCAGCCCAGATCC
AGGTGTACACTGAAAGGCTCTCACTAGATTTCGCAAC