Description :
From Genome Similarity Track
Location :
Scaffold_1523:4769- 6278
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1523-snap-gene-0.6CASP

Sequence
1509 bases(100 bases per row)
GATCACGTCGCGGATGAGCGTGTCGATGAACGATCGCACGGGCACCGCGTCCGCGGAATTGCGCCACGAAGGGTCCAAGTGCATCAGAATCGCGGTCGCC
GTGATCAGGTAGCCGTAGTGGTAGTGGTGGNNNNNNNNNNGCGCCGCGAAAAGCCCCTTGTAGAGCATGAAGAACGCGTTCTCCGAGTACTTGGCGCGCT
TCGTGAGGTTGTCGATCTCCTCCTGGTACGCGCGCAGCAGTCCGCCGATGCCGTGCACCTTGTCGCTGTCCGAGAGCTTGCGGAACGTCTTGGTCGTCTC
TGCGAGCTTCTTGGCGACGAGGCACATGGTGCCAAACTTTTGCAGCGCCTTGCCCTTGAAATAGTAGCTGCCTTCGTGCGGAAGCGCTTGGTCCCAGTCC
CCGTAGATCTCGTCCTTGACAATGCCGGCAAGGTTCAGCGCCGCGACTTTGGTAGCAGGGAGGTCGGCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGTGAGAGTGAAG
CGTGAGCTCGGGATTCACAACCGCACCGGACGCCGACGCATCGAACATCTGGCGCAGATGGTCAAGCGCAAAGTGCAGAAACAAGTTGCTCTCTGCACCG
GCAGCGATGACGAGGTTCCAGTCGAAGCTGAACGCATCGGCTTCGTTATGCAAGACGGTGGCACCTTTGGCGAACACGCCCGATGTCGAGTGGTAGAGCT
GCAAGATGCGCGTGTCCGACTCGGCGTCAGGTGGGTTGTTCGAGACGTACGCTGCCTGAACAATGCCGTTGAACTTTTGCGTCGTCGTGAGCTTGTTATT
CTGGAAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGATGGTCGTGCCCTGGTTGCTTATCCCATGCGTTGGGAAAAAGTACAAAATCCATTTCTG
TCCATTGTTCAGCGTCACAACGAAGTTTTGCCCAACGTATTCCTGGCCTTCGCGAATCGGCTGGTTGTTGATCGTGAGCCACCCGTGGTCCGAGCACAGC
TGCACATGCAGGTCGTCGTATTGCACCGTCGTGAACGCGCTGCCCACCGCCAAGTACGTGCGCATGATGGCCGCTCCCATCGCCAGCGTGAGCNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCAAA
CTCCTGCGCCGAGAAGAGCAGGTTCTTGATCGTCGGCGGGTAGTAGTAGTACCGGATCGCGTCGTTGTCGTTCTTCGGGCCGTCGACGCGGTACTGCGCC
AGGTAGCTCACAGACAAGCCGCAGCCGATGGTGCCTGGCTGGCCCTGCACGACCTTGTACGTGTACGGCGAGCTGAAGATCGCGTCGCTCTCGCGCTGGC
CGTCCCACG