Description :
From Genome Similarity Track
Location :
Scaffold_1:476763- 478838
Transcript NameFunction/comments
Hyaar_Emoy2800116septum-promoting GTP-binding protein 1

Sequence
2075 bases(100 bases per row)
GACAATACAGCTTTCACTTCTTTGGTTGTGGAGTAGAACGACAATAGTGGCGGCATGGCAGCACAACGGTTCCCTTCTTCCATATCATATTAGTCCTCCG
CATGACAAAATCACCAGTACCACAAGTCCGACAACATCACCTGCTTCAAATGACTTTGCAAGCTCTCAAGAGTTGTCCCCGCGAGAACGCTTTGTGGTCA
AAGATAGAGGGAATTCGATTCTTCCAACGCCGAGCCGGTGTTGCAACGCACCTGACCTTGACGACCTGCAGACTAGAGGTTGTCTGCATACCATAATTAG
CGTCACAAATGAAGACCGTACTTTCGAGCTAGATATGCAGCGGCTTCCAATAGATGTCATCCCTAGCTCACACTGCTACTCATTAGCAATAGTCTGGCGC
CTAGCGCGACCCAATGGATTGTTGACAAGGCGTAAACAAGGACCGCTTCGATAACATCTGCAGGTTCGCCTGTACGTGTGCTGCATGATATCATTTCGTC
ATGTTGAACCTCGTACACCTCGTGACTGATCTGGCTGCGCTACAGGCTCCGCAACGTGAGTCAGTCTCCAGCTGCAATTTCCAGGAACGGCGAGGATTGT
GTCAACGTTCCTGTGCAGTTGGTCGACTGCAAACTTTTGTGAGTTGAATCTTGGCGATGAAGGCGGAGAAACTGAGGCGACACGAATATGACACGAACAC
GTGTGCTCGTGTCAGCAGAGCGCATCGTCACGATCAAAGTAGAACAAAACGCCTCTGGTCAATCGACGAGTCGGACTACTTATGTCCAGTTGCCATACTG
ATGAGTTGTAATTCTGGACGCACGTAGCGTTCATCCGAAACCTTGAGCAGTGCATCAATGGAGGCCACAACTGCTGCGTAGCTGTTTGCTGCACGTATGA
ATTGACACGCAAAACAAGTGCAATGTAGAGATATTTTCTGGTTGCAGTGAGCGACCACGGCACCGGGGAAATCATAATACCACGGGCTACGTACGGGTAA
GTGGATGTATTCTACAGGTTCGATAGCTTAGTAACTGCAGTCTAGATATTGCGGTTTGGTGATTGGGTGCGGCGAGCAAGTTTAAGCCACAAGACGCGTG
GTTAATGGCATATCTTTCGCGCGTGTAACTAGAGAGTAAGTTAAAATCGGGCCACAGGAATGGATAGACATGGTGTTTGTGTTTTGTTTGGACGAGTTCT
GACCATCTTCTTTTGCTCTGAATCACTGTGGGGATTCTTCAAGTAGACGCTGTCATTGAAGTCGATGAAACATGTGATCAGTACACGAGACAAACGCTGG
AGTCAACGTGGTCGACGACGTATCCAATGACTACCAGCCAGCCCCTGCGCTACGACAAACTGTGTCCCAAAAAGAAGGTAGCAAAACAAAAAGATCCAAC
CCGTGCACGAGGTCGACGACGTGGGGTAAGGAAAAAGCCGGATTATTCGCGATCGATCATCGTCTGATTCCGTAGACAAAAAGTCAAATCCGATAGCGCC
CAGACTCTCCTGCTTTTATCCGTTTTTTTGTGAGTTTTCGTTCGTGCAATCGCGTTAAAATGGCTGAAAAGCGAGTCGACGCTTCGAGTACAACCACGAC
TGGGGCGCGTGTCGAGCGAGCGTCTCGAGGCGTCGGCCCAGCAGGCGGCTCTTCTGCCGGTGGCAGTGGGTCCAGTCGCAACAACGTGGTGGTGAAAGTC
GGTATGGTGGGGGACGCCCAAGTGGGCAAGACGAGTCTCATGGTGAAGTACGTGGAGGGCAAGTTCGACGAGGATTATATCCACACGCTGGGCGTCAATT
TCATGGAAAAGACCATTGCGCTGCGTAATACGGAAATCACTTTTAGTATCTGGGACTTGGGCGGCCACCGCGAGTTCATTAGCATGCTCCCGCTCGTGTG
TAACGACGCAGTTGCGATTTTGTTCATGTTTGACCTCTCCCGAAAGGCGACGCTCACGAGCGTCAAGGAGTGGTACCGCCAAGTACGCTCGATCAATAAG
GTGCCTATTTATGTATTGCTCCGACTTTATTTGGTGTGTCCGCTACTGACGTTATTGACATTATCGTTCTTGTTG