Description :
From Genome Similarity Track
Location :
Scaffold_23:476681- 484592
Transcript NameFunction/comments
Phyin_T30-4PITG_11327Annexin (Annexin) Family

Sequence
7911 bases(100 bases per row)
AGCTGAACAACGCGACGGTGCCGGTCCAAACACCAATCCCGCGAAAGGATGTGTTGTTGAACAACATGGCCGGTAGCGTACTTTTCAGTGCGCTGGATTT
GGTAGACGGATACTACCAGATCCTGATGCGAGAGAGTGACATCCCGCTCACCGCGGTGAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCG
CAGGGCTTGTCTAACGCCCCGGTGACGTTCAACCACCTGGTGACGCAATTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTACTTCGACGACATATTCG
TCCATAGCCGTGCCGAGGAAGGCAAGACGGCCATGGAGGTGCATCTGGGGTACCCCCGTCGAGTGCTGGACGTAATGCGAGCGAACAAGTTCTACGCCAA
CATCGACAAGTGCGTCTTCGCGTCACCAGAGATTAAGGTTCTCGGTTGCTTCGTAAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATA
GCAGCATGGCCAACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTCACAAGTACAGTGCAGGGTACGCGGGCTTCGCTG
AGCCCTTGTCGGGCCTCCTTAAGAAGGGCGTCGACTGACGCTGGGAGCAGGAGCACCAGGATGCCTTTGACAGAATCAAGGCCAGTCTCCAAGAGGCCCC
TGTCCTGACCCTGCCAGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGACTGTGTCATCGGTTGTGCACTGCTGCAGGCCGACACGGCTGGA
CATGAACGCGTCATATCGCTCCAGTCTTGGCAGCTCAAAGCCGCCGAACGGAGCTACCCTGTCCACGACAAGGAGCTCCTGGCAATGAAATATGCCCTTG
TGAAGTTTCGTGTTCACTTTCTGGGCTCCCGGCCCTTTGTGATCTACACAGACCACACGTCCTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCAAAA
GATGGGGACGTGGCTGTCCTACTTCGCGGAGTACAACTCTCGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCA
GACTACGAATTGGCCCACATCACACGGGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCGGTACGATGAGGCTGTCGCGCCTATCGTCAAGT
TCTTCACGGCAGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGATGGCCTCCTCTATTACCG
GGTGGGGCCCAATGAACCTCCACGGGTGGTCGTACCCAACGACAAGGATCTGAAGTTCGACATTCTCGCGGAGGCGCACGACGCGCCCTCCAGCGGCCAC
TTGGGCCGCGAGAAGACCTTTCTGTCGGTATCTCAGGCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCATACATGAAGATATATGAAACATGTCA
GCGGGTTTAACCCGCAAGGCACGCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGACTGTTGGAAGTTGATGAGTCTTGACTTCATCTTTGGGCTT
CCCACCGACGGACACGGAAACACCAGAATTTTTGTGTTCGTGTGTCGGCTGAGCAAGATGGGACATCTTGTTCCGGTCCCCGTCACTGTTACGGGCGAAC
AAACCGCAAGGTTTTTCGTCGATGGCGTGCTCCGCTATCACGGTCTCCCGGAGACGATTGTCTCGAACCGAGACCCGCGGTTCACGGCTGCGTGTTGGAA
AACGCTGTTTCCTTTACAACGACGACGCCTCCGCCGAGCGTCGGATCTGATCCTCGTTCAGATCGACGTCGCTTCAAGCGACTCGAAGTCCAGGGCCCGG
GCTCCTCCGACACGGCCGGTGGAAGTGTGTTATCACATCTTCGATGGCGGGACCGGTTTACCCGTCAAGGCATCTGGTGTCCATTTGGAACCGTTGCCAG
AGGTTGCCGAGATACTGAACCTTGAGGAAATGATGGTCGAGGCTTTCCTGGCCAACCTCAAGGCTGGAAAAGGTTGCCGAGATGGTGCTCATAAGACCTG
AGACCACTCGGGAGGAGCTGAACGCCTCCTCTGTCTTAAACGAGGACGTCCTGGAGGACCTAAACAAGCAGCGTCAGACGCGCTTGGGTTCCTAGATCCT
TAATAACCCCAAGGATCGGTGTATCCCTTGGGTGACGGAATTATGCGGAGCGGGGTGAAAACAAACCACCCACGCAACCCAAGTTTTTCACCCAAATCGA
GGGTTTGCGACTGAGACGAAATAATTTCTTTTTTCTTGCGTGGCACAAAGTACTGTGTCACGAGACAATGGCCTCTTCCACGCGAACAGTGCGAGGTCAT
TGATGCCTTCTTCGCTGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTTGAAGTCCCCGCCCTCGACGCCAACTTTCTGCGTTCGGAAGCCGAACGGAAAG
TGGCATCTAGTTCATGCTTATAACAAGCTGAACAACGCGACGGTGCCGGTCCAAACACCAATCCCGCGAAAGGATGTGCTGTTGAACAACATGGCCGGTA
GCGTACTTTTCAGTGCGCTGGATTTGGTAGACGGATACTACCAGATCCTGATGCGAGAGAGTGACATCCCGCTCACCGCGGTGAGCACTCCAAGCGGCAT
GCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGTGACGTTCAACCACCTGGTGACGCAATTGTTCCGCCCTTTGCGTACCTTCGTA
CAGACGTACTTCGACGACATATACGTCCATAGCCGTGCCGAGGAAGGCAAGACGGCCATGGAGGTGCATCTGGGGTACCCCCGTCGAGTGCTGGACGTAA
TGCGAGCGAACAAGTTCTACGCCAACATCGACAAGTGCGTCTTCGCGTCTCCAGAGATTAAGGTTCTCGGTTGCTTCGTAAGCAACGTGGGCGTTCGGGC
TGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCAACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTCACAAGTAC
AGTGCAGGGTACGCGGGCTTCGCTGAGCCCTTGTCGGGCCTCCTTAAGAAGGGCGTCGACTGACGCTGGGAGCAGGAGCACCAGGATGCCTTTGACAGAA
TCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGACCCTGCCAGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGACTGTGCCATCGGTTGTGC
ACTGCTGCAGGCCGACACGGCTGGACATGAACGCGTCATATCGCTCCAGTCTTGGCAGCTCAAATCCGCCGAACAGAACTACCCTGTCCACGACAAGGAG
CTCCTGGCAATGAAATATGCCCTTGTGAAGTTTCGTGTTCACCTTCTGGGCTCCCGGCCCTTTGTGATCTACACAGACCACACGTCCTTGAGGACGGCGA
CTAACTCGCCTCACCTCTCCCAAAAGATGGGGACGTGGCTGTCCTACTTCGCGGAGTACAACTTCCGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCT
TCGGACGCCCTCTCTCGGCGTCCAGACTACGAGTTGGCCCACATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCGCCAGTGCACACGCGCTGGATCTCCTGCGCAGCCGCATCGATGTCTGCAGAG
AACGTCATTGACTCCAAGCTGCTGCTGCCCTCGCGTGCGTGGCGAGTGTAAAGACTACTCATCGCAGCCGTACCAGCAGCCACCACAGTGGCAGAGCTGG
GCTCACCGCTCACGCCAGACGTCTCCGTCTTCGAGCTGCCAGACACGCTCCTCGTGCCAGCCACACTCTCCGTAGCACGCGCGCTCACTGCACCACTCGA
CGAAACGCTTGCCTTCTCATCCACCGAAGCACTCATGCCGATGGCAGCACCACTCACAGAAGCGCGCGAGTCACTCATGACAGTGCTCGAACTCCTCACA
GCAGCACCACTAGTCGAACCAGATTCCGACGCAGACGCACCGAATTCCACCTCCGCCGCATCAAACACCGACAGAAGCAACTGGCCGTACTCGCCGCTCG
CCACGCTCTGGATTCGCGTGCGCAGCTCTTGGCCGTATAGGCGCATGTACACAGTACGAATGCGCACAAGAAGACGGTAGTACCGCACAACCCACGCGCT
CACACCGTACGCGCTCTTGCCGGCACTCGTCAGCGTCGTCTCGAACAGCTGCGCCAGTAGCTCCACCGGCTCCAATACCGACCGCACCAGGAACAGCAGC
GCATGCTTCGCGCCGCCAGAAAACTCCGCGGTGATTGCGCCCACCAGGCCCGTATTGTATTTCGCAATGTACGCAGTGTTAATGTTGCGCAAGTGCTCAG
CAGGACTTAGCACTAGGATGGTGATGAACGTCGTCTCATCTGTGCCCATGCGGCCTTCACCGGCCTTGTACAACGCATCCGCATCCGCAGCAGCCTTCGC
GCTCGTGTGGATCGACGCGTTGAAGTCGGCCACCTCGCCACGCATAGCCGCCAGGATCACCTTCTTCAGATCGCCGCTCAGGTCGCTGCTTAGCACCTTC
ACCAGGTCCTCGCCGTACTTCTCCTGGAACGTCTTCTTCAATAGCGCGATCTCAGCGTTCGAGCGAGCCATCACCACCGGGTAGATCCACTCCTCTGTAG
TGCCTAGGCCCTTTGTCGCCTTGCGCAGAATCTCCGCCTCCACTTGCTCTAAAGGACTCGCCAGCATCTGGAGCAGAACGCCGTAGTTGCTCGTGCTCTT
CACCCACACCGTCAGACTCTGCTTGAACAGGATGCGGTAACGCCACCAAATCAGATAACGCTGCTCCACAGTCTTCGACAGCAGCAGCGACGCCAGCGCT
GCCTCGTCAGAAGCTGCGCCAGTGCACACGCGCTGGATCTCCTGCGCAGCCGCATCGATGTCTGCAGAGAACGTCATTGACTCCAAGCTGCTGCTGCCCT
CGCGTGCGTGGCGAGTATATAGACTACGCATCGCAGCTGTGCCAGCAGCCACCACAGCGGCAGAGCTGGGCTCAACATCGGTCGCGGTTGATTTCGAAAC
GGCATGCTTGAGCTTGGAAGGATGCGGGCTCCGATTTATTGTTGGTGCGGGATTTTGCAGATTTTCGTCTTGTTTTTCGTTAGGAACAGATTTCTTGACT
TTGTTGGACAGGTTTGCTTCTGTCAAGAGAACGGTATCGTCAGGGAAGTTAACGAATGAAGAGATATTTTGGACGTGTCGGTTCTCCTTGTCTTCGTTTG
CACGATCAACGACAGTGACGCGGTACTGGCTGGTACCGCTACCACTTAGGCCAAGCAAGAACTCCTCGTTGTCGATGTTCTGTGGCTGGGCAAACCCAAA
CTCTTGGAAGAGCCGAATGATGAACTTCGCGGGGCCATAGAAGACCGTCTCACCGCCCTGCGTGATCAGCACATTTTCATAACCACCGGACAGCTTAGGC
GATTTCTTCAGCATGGAGGTCAGATCTCGTGCATTGGCGGCGTCTGGGACCTTCCTGTTCTTATCGGACACTTCATCGATCACCAAAACACGCTTGAACT
GTCCGAGCTCAAGACCAAAGTCGTGAGCAGCAAGCTCGGGGAACTGTACTGACAACGTCTGAGACACGTTCCAAGCTGCTTGCTTTTCATCCAACGAACC
AGTCTCGTAAAAGTTGTCACTGAAGTTTGAAAGATTCGTCAAGCAGAAATCACGCGAAAGCTGACGGACCTCATGTGAGACAATATTCTCGACGTCTTTA
CCCCTTCTTTCACAAAAGCTCACAAACTGAGCATGCCACGTCCATCTAAACAAAGATTCCCTTCGCCTTGTGCATCTTCGAATCGCCTTTACAGAGACCC
AGAACCACAAGCGTGTCCTCGTACGTCAAATTCACATTCCCTGCTATTTCAGAAGAGACGAGTCCATGCTTCAAACCACCAAAAAAATCACTCATCACCG
TCTCCGTCGTCTCCGTCGCCTTCTTCACCTCCGTTGTTGTAGCAGTTGAGCCATCATCGCCGTGTTCAGGCTTGGAACGGGTGGCATGCACAGCAGAGCC
GATCACACCGCCAGTGGCAGCGGCCGTAGCGACACCGATGGCAGCCGTCGCCAGGCCACTCACCTTCTTCTTCTTATCGCCAGAAACGTCCTCCGACGTC
ATAGGAGTCTCCTCCGTCGTGGTCACCTCGACAACCGTCTCCGTCTCCTCGGAGGTCTCGGGTGTCTGCTTGCTCGATCCCGAGCCCGCGTCACTCGTCC
AGCCAGATGATACAGCGTAGCCGCCGCGTTCAGCCACACTGCGGGTCACGTCGCCACTCACGTCTCTACTTGCCAAACCTACAGCACGAACAATATCGAG
CTTGCCACCCACAATCGCTTTGATACCAGCAGAGTCGATCACGCGGATATTGCGCCCTGAACAAATGCGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATACGGTTGTCCTAAGGGGGTAAACAAC
TGGGCACTCCCCCCCGTTCCCCCCCCCCCCTCCCCGGCAGAAGGAAGCCGTTCGTCCCCCCTCCCCGGGGGGGCCTCCCTAAGTCCCCAATTGTATCTCC
CCGGCCTTAACAAAAACCGAAGGCGTCGTGCCCCTTTCCCCTGGTGGGGTACACAGACGCCCCCGATCCTTCAATTGCTCCGATTGTCGGGCTTCGGACA
TCCCCAGACGTGGGTAACTAAGCTCCACGTCACGGTCGCCGTCGACGACGACGACGTCGCTTCAAGCGACTCGAAGTCCAGGGCCCGGGCTCCCCCGACA
CGGCCGGTGGAAGTGTGTTATCACATCTTCGATGGCGGGACCGGTTTACCCGTCAAGGCATCTGGTGTCCATTTGGAACCGTTGCCAGAGGTTGCCGAGA
TACTGAACCTTGAGGAAATGATGGTCGAGGCTTTCCTGGCCAACCTCAAGGCTGGAAAAAGGTTGCCGAGATGGTGCTCATAAGACCTGAGACCACTCGG
AAGGAGCTGAACGCCTCCTCTATTTTTAAACGAGGACGTCCTGGAGGACCTAAACAAGCAGCGCCAGACGCGCTTGGGTTCCGAGATCCTTAATAACCCC
AAGGATCCGGTGTATGCGGACGGGGTGAGCAAACACCCACCGACCCAGCTCTCACCAGATCGAGGCGTACGGCATGAGATCGATCTCGTGCCTGGCACAA
AGTACTGTGTCACGAGACAATGGCCTCTTCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCTGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTC
GAAGTCCCCGCCCTCGACGCCAAATTTCTGCGTTCGGAAGCCGAACGGAAAGTGGCATCTAGTTCATGCTTATAACAAGCTGAACAACGCGACGGTGCCG
GTCCAAACACCAATCCCGCGAAAGGATGTGTTGTTGAACAACATGGCCTGTAGCGTACTTTTCAGTGCGCTGGATTTGGTAGACGGATACTACCAGATCC
TGATGCGAGAGAGTGACACCCCGCTCACCGCGGTGAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGT
GACGTTCAACCACCTGGTGACGCAGCTGTTCCGCCCTTTGCGTACCTTCGTACATACGTACTTCGACGACATATTCGTCCATAGCCGTGCCGAAGGAGGC
AAGACGGCCAT