Description :
From Genome Similarity Track
Location :
scaffold_25:476666- 478849
Sequence
2183 bases(100 bases per row)
CGTTGATGTAAAATGGCGTAAAGCTAGTTGAAGCATGGACCGCATTGCTGATGGTAAACTCGACCATCCGAAGAATAGCACTCCATATCGACAGCGACAA
TTCGCAAAAACTGTGTAAAATGCATTATCGACGCGTATCACGCGTTCGTTGTAATCATTGGTCTTTGGGTGGTCCTTGGTGGCCATCTCAAGGTGAGTAC
ATAATAAACAGAATAAGCTTGCCCAAATGTCCGCTGTAAAGCGCGTGTCACGATCGGATATGATTGACTCTGGTAAGGTATGATGTCGAAAGACATCATC
GATAATAAACGGATGTTCTGTTCGCCAGTAACCGAATTAACGTTGGTGCGAGGTGCACCATCTTGCATCAAACGGTCTGCAAGACCAAAACATCATTATG
CCCAGGGGCAACAAGGGGTTATTACTCAAAGAAAATGTCTAAACTGACGGGCCGCCAGCAATCTACTGATACTGGCAGACTGGATAGGGCTTCACATGCT
GAATTCGCCACATGTACAAAGGTACTTCTCAACCCAAGCATACATTTTGAGCCACCAAAAGTGGTGTGCAAGCGCTGCATAGTCTTTTTTCGACCGTGAT
GACCCGTATTAGACGTATCATGTGCTTCATACCCCAACTTGTGCTTCGATATTTCGTTGTCGGGTACGACAACCCGAGATTTATCTCTTCATGTACTTGT
TGGATAACCCATCCTCGAGGGAGTCTCGATGACTTCTACCGCGAACTCGCGGAGATATTGTCGAAAAGACTGTACTTTCCGTATTTATCAGCCCTTTAGA
AACAAAACAGCACAAGCTGGGTCGTTTAGATACACATGCCGTATCATGTCGAATACGTTTGAAGTAGCTTGCAAAATTACGGGTAATTCGTAATCGGGAC
GCCGAGATAAGGCATCCGCCTGGACATTCAATTTGCCTGGCTTATAAGCCATTGATAAGTTGTATTCCACAAAGAATAACAGCCAACAGGCCATCCGTTT
TTGCAAATGAGGAGTTTGAGTCGCTGTACGCAGACATGCGTGGTCGGTAGAAATAACGAATGGCTTGGACCCCACTAGTAAACTCTAAGCATCACCAAAG
CATACTTTAACGATTCATTGTCGTGAACGAGATAATGCCGTTCAGCTGCCTCAACTGATACGAGCGACATATTTTTGTCCATTAACATCTTGCTGCAGCA
ATGAACATCCGATCACAAAGTTGGAAGAGTCGCACGCGACACTGTACGGTAAATTGTCATTTGTTATGCCAATATAGGCGCCGCCTGCAAGTGTGTTGAC
ATCGTCTTAGGATACTACACATTAATGTGTCCATAATCACTCTTGATCTTTCTTCAACGAGTCCAATAACGGGCGTGCCTCGTCGGCATAATTAATGGTA
ACTGATGGAGATAGTTGACCAAACCCAATCACTTTCTCAGATCCTTCCGGTTAGTTGGCGTCAGCCATTCTAAGATCGCTTTGAGCTTCGCTGGGTCTGC
TCGAACACCGCCGAGGCCGACAAACAACCCAGAACTGATACGTTTTTGGCGTCAAAAAATATACATTTATCAATTTTGGCCAACCTGATGATCTGTAATG
CACGTTAACCTGTTTCAGGTGTTCGAGAAAAATTTAATCGATAGATTGGCCTGCTTCGGGTGTTGAatggacaaaaatgtcgtcgaaataCGTCGACGCG
ATCGACCGCAGTGCATACCGAAACAGTCTAACGTCGCTGACGCATTGGAGATTCTTTGTGGtatcacaagccactcccaaagcatacCTTTAGGTGTGCT
CACTGCGGTATACGGAATCGATGGAAGATCCATTATAACTTGATAGTAGCCATCTACTAGATCAAGTAATTTAGAGGCGTTCGAGCCGATTATCTTGTTG
ATAATGGCACCCTAGCAAGGAATAGGGGTCTGGGCTGGCTCATTTTTGGCGTTTAATTTGTTGTATGCGCGTACAATTCGCCACTTACTATTGGATTtgc
gaacacaaaacgttggCGCACTAAGGGGAGCTTACTCTTTCTCACCCACTCCAGTTGCTGTTTATCAGCAATGAACGAGAATATAATCTCGGATTGCTTA
GGTGGCGATGGCCATTGACGCAATAGCAGATATCTTGCACCTGGCTCAATCTCGATCTAGTGTCGTATACCACGATCTGGCGG