Description :
From Genome Similarity Track
Location :
Scaffold_76:47661- 48773
Sequence
1112 bases(100 bases per row)
AGGATGCAGGAAAACTGCCAACAACATTAATGGCTGTTCGCACTGCTTCCATCTACCTTCCAAAATTGATACCAGTTCCAGGTTGTCCAAATTTCCCACA
AAGCCTCGATAAATGTCTCGGTAGGATGCTACTACATCTGCCAGAGTATTTTCATCACGTTGCAGTTTGAAAGATGCATTCGAAAGCGGGCGGATTACTT
CTTCAGCCGACGCTAACCTACTCCAAAACGTTGGATCCTTGAGAGTCTTAAGCGACTCCGGAAACTCTGGATCCGACTCATACTCGTCTGCAAACTGCTC
TAAAGCAGTTTTCATGCGCAGCAGGGATGCAAAACATCCTTGCATGCTGTTCCATCGGGTTTCGCATAGGTTGATAAAGCCAAGGGTTTTTCCATACACC
GTTGTAACAGAAGATTTCGCACGAGGAAGCCATTTCGATGACGATTGGTTCAAGGTTACCGTAATCTGTGAAGCCAACTTGGTAACCTTTTGGTACGACG
AATTCAGCACAGCTTTAACCAAATTATTGCAGTCGTGGGCAAAGCAATGGATGAACGCAAGATTGGGCCAACGGAGTGCCAAAATCCGTCTGGCACGGTC
GCACTGGCCAGCGTTGTCCGTGACAACACCTCCAATATTCCATCCTTTTGTTTCTATGTCCTTCATTGTTTTTTCCATTTGTTCGGCGATCGCAAGCCCG
TCATGTCTTGACCCCGTAGGAAATAATCCATAGCTCGAAATAATTCCATACAATCCCAGTTGACACCCCAATAAGTGAGTCTTAGAAGTATTCATCCATA
CATCCGAGAGAAAATTCACGCGACCTTTAGTGTACCGTTGTCGATTTCGCAGTGCTTGAAATTGCTCTTCTTCATTCACAGTACTGTACTGATTCAAAAT
GCGGTTTCCAAGGTCAAACCGATTCGGAAGAGCTTTTTCACATGCTCGATTGAGAAAAACGAAGAGACGACGCGTTGACTTTTTCTCAATGAATCGATCT
GTCAAATTGTTGTCCGCCTGAAATTGTACCAACAAGCGCTCAAATTCAGCTTGATCTTCTTCATTAAAGACACTAGCGTAGTAGTCTCGCATGCGCCGTT
GCCGCTTGTCTG