Description :
From Genome Similarity Track
Location :
Scaffold_798:4766- 6499
Transcript NameFunction/comments
Phyke_g11059acyltransferase family

Sequence
1733 bases(100 bases per row)
ACAAGTATCTTAGCTTTTCGGTCGATAAGATTTATCTTGCTCCTCACTTTCGAATTTCACCACCACTGGTTCGTGATGTTCTTAGATCAAGAGAGCGAAA
TACAATTTCCTCAAGCGGCTCTCATTGCCGATTCGCGTTGTCGAGTACTCGATTCCcgtgttgttgttggacCATGGACTGAGTAACACTCGAACCTTGC
ACACGGATTTTTGACAGCTCACATCGTACATGTACGATAGTGCTCGTAATCGAAATGGTGCCTCCTTCAAGCGTGTCAACGATTTTTGCCTGAGCATGCT
TCAGTGCTTCGGTGCCGGGGTATAACTTTTTAATAGTTTCGCTGTAACCCGTGGTTCCGAACCCCACGATCAGAACACGTACTCCATCCAGTCGTTGTCG
GCAGATATTCAATGAGTATCCAAACAACTCGTGACCCAGTGACACCCGAAAAGAACGGCTGGGCGACATGACCCGCCAGCGAAGATGAACAAACAGCGCA
GTGAAAAAGAATTGAGGTCGTATCTCTACATGTATTGCGCTCTCAAATAATGATAGGTGCGTGCAGCACTTCTTATTTGACGCCTATGTGAGCCTTTTGC
TTGTTGAAGGTAATTTGCTCCATGCACGTGAATTTCGTCAAGCCATCGGAACTTTTTGCTTCCCAAGCTGCGAGGAATCGAGAGATTTTCTGCGCCAGCA
GCTGGGACGGATACTCGACGAGGTAGTACGTCGTTgatgccaacaagaagatcAGGAAGAATCGAGAAAATAATCGGTTGAAGTACTTGGGCTGGGCACT
GATCGTAGGGTTCCACACGACGAAAGAGTGCAGCAGGTAGACGGAAAAGCTGATCTTGCCCCAATATCGCAATATGTTCCACTCGAACATTGTGGACACG
CATGACGGATGCACCATTTCGATGATGAAAATCAACGTCAGCAGTGCGCTAACAAATGGGAACCCTTTGGTGTTCGGTGCGGGGTTCTCGAGTACCCAGT
CGAAAAACAGTCCTTGAAAGCACACACTTAAAAGCATAGCGATAATCGAGAACTCGATCGCACGGATTACCAATGTGTGTCGTGTGCGGAATTCAAACCC
AGTCTGCTTAATCCATGTGTCCAATTTCACGAACACCACGGCAGTTAACGAACCCGATAGGAAGGTTGGGATATGAGGTCCAAGTGGTGTGTGACTCGTC
CTGTACTCGTACCAACCTTCATGGACAACCCAAGCGAACAGTGGAAACACCGCCACCCACCAGAAGCGACGCATGCCAAGGATGGCCAACACAAACACGG
GGATCACGAAATAGTAGGAAATTTCCAGCGGTAATGTCCATAACACAAACCAGCGATGGTCAAAGTCGAATGTCAGCATCTGGAGCAGATCAAAATCGTC
TGGAGCTTTCACAAGGTAGTAAACATGCTGGTCCTCAAAAGACATGAACGACAGTGCAATTCCCGTAAGCGCGAACAACGGGTATACTCGAAAAAACCGT
TTGGAGAAATAGTCGACCAGCGTGAATCCCCACGACCGGAGACTCGCACCTTGCACCAGTAGCTTCATGCTCCTCTTCATAAAGAGCCATGTGAGCAGGA
AAGACGACAATACGAAGAAAgcgtccacagcaacagcacctAAATTAAGTTTCTGCATGTACTCGTGCGAGTGCTGCGTTacgacgaggatggcagcGAG
ACCTCGAACGCCATCAAGGAATAACACCTTCGT