Description :
From Genome Similarity Track
Location :
scaffold_3:476525- 479086
Sequence
2561 bases(100 bases per row)
AAAATGCAGGATGTCGTTGCTTGCGAGTAGGTATGGCTGGCGGATAAGCATCTCCATTGCATCTTACACCTTGGAAGGCCCAATAAAGCTTGGTGAAAGC
GTTCTGTTCTTAAATTGGACGCTTCACATTCAGGCAGATTTTTCGTGCTAAGTAGTGCAAGATCTTTGACCTTATATCCTTTCTTATTCTTCCTTACTCT
TTTATCTTTGTCTTTTTTGCAGATCAAGATCTTTGGCAATTGCGTCTGAAACAAACCGCACATCTTCTTCCCGCTCCTGTCTACCCTGGATGCAGTTCAT
GAACCGAGATGCTACGTATAAGATTAACCTACTATTGATTACAAACTTCTAGTAGCGGCTTTGATGCCAAAGATAGCTTTAATGACAGGAATCTGTTTTG
ACTGAAATGTGACGACGACTTGTCGCTTCATAATGAAGTAATCGACGTGCCGATCCCCACGACTTATTCGTCTTAATGTCTCAATTAATCAGGGCTCACT
TTTAACTCTTTGACAACAGCATCGATGTCTGAGTTGGCTCCGTACCTATTGTTTTTTCCCGCTTAAGGATGAGACCTCACTAATTATGCAGGCAGGTACT
CAAGGATGAATCCAATAGTTCCATAAAAGGGCTAGTGGACTATCTAGACAACGTGGAGTTGTTTAGCGTAAACAATGGGAGAAGGAAAAATTTACTCCGT
TTTTTAAACGACGCAGCGAAAATACGCAGTACGTCCTCCAGGACTCGATTCACACGTATTTTTGACCGCCCGTTTCTGTGTGTGCCTTTGTTGATATGGA
CGAGCCGATATCCATTTTTCCCAAAATCAGGAATGTTACCCAAAGTACGTTTAGACTTCGATGTGAAACGGGTGCCACGGCCAGACACATAGACCATGCA
GGCGGATTACAACGTATATGAAGATTAAGCTATTTTTTCGGGAGATATTTTATTCGAAACAGGCGCACGATAAATTATGCTACTAAACCAGTCCACTAAT
ACAAGGATGTCGTTGCGTTCACGTATGCTCGCGAAAGTCCGTAGATGAAATCCATACTCGCAAACTTCCAGCTGTCAGCTGGCAAATCTCACAAGTCCCC
ATTTTATTGCCCATCCACGTATACATATATGCGCCAAATCAAGCACGGGAAAGCATGAGAAAGGTGATCATACGTCCGAAGTGGCCACACGAAGGGTTGT
CGTAGTACTCATAAGAGAAACAATGACAAAAACCCTCGTCAATGTGATCAACAATCCATGCTGTATCCCCGAGGTCGACCGCATAGTACAACATTCAAAA
CGATGAACACGCGATCTTGCTTGACACGGAATGCCTTGCAATGCTTTGTCAGAAAGATCCTTGAAGTACTTTAACGAGTCGtgacatgtctcatcagACT
TTTACCcttcaatttttttcgcGCAATGAAGTCGCATCTTACACGGTAATCGTCTCAACATATTCATATTGTCGACATTACTCGTGCATATATTTACTTA
TGGACTTTCGAGattgacaacgcatcggctAAGACGTTCGTCTACCTGGATTGTAGTGAACAacaacaaagttgtactcggcaaagaagaataTCTATCG
AGCCATTACCTGCCAATAATGTGGAGTCTTTACTGCCATTGCTGCAAGGTATGATCTGTATCGATCGCAAAGCGCTCCTCTTCATGCAAGTACACACAAA
ACTTGACAAAAAGCATGCTTTATCGTGAAAAGCGCTTTGTCATAAACTTGTTCGTTCCGTTCCACTGGTCAAAGTTTTCGCAACTGATACGAAACAATTT
GATTTGGACGTTCTTTATCGTGATGTATCAACGCACAACAGATAGCATTGGCATTTGCATCGCAAACCACTTGGAATGAATTATCGTGATTTGTATTCCC
AAGGACAGAAGGTTCTCGCAGCATCTTCTTTTCTTCGGCAGATACCGTCTGGTGATCTATTTTACCAATCCAACTTAATGTTATACGTTAAAGGAGTCGT
TAGGGGGTACAGATTTGCGcttgtatttgtgcaaatagaTATTCAAGCTTAACTCTTGTACCGGCTGTTCCACATGAGATCATGTCCGGATCTACACGAA
CGCCATTCTTGTTCACGTAGCAACCGAGAAAGGGATCTCAGGTGCAAAGATAAGATTTTGCACTAATTCAAGTTATTGTAGTGTTTATTCTCTCGCATAA
CTCAGAAGACTTAACGAAGCAGATCAAGAATGACATCAGCATCAGACTTTTCATTCATTTAAAAACTACTGCAAGCTGTACTATAACCTTGCGTGGAGCC
GGAGTCTTAGCCGGTGTGGTCGAATCGCCTCTTTATTGAAAGCGTGCACAATGCGCCCTTCGTGCTGCGTTTTTTTCACGCAAATGGTTGGACTACAGTA
CGGAGACTTAATCCCACGCACATGACCGGCCTTCTGTCGCTGCGCAAAGAGCTTGTCAATTGCAGTGATTATATCTTTTGGCACCGGCCACTGTCTCGCG
ACACAATATTTTGTATCAGAAAGTATGTCAGCTTCATAAAAATATCTCTATCAGGTGGCAA