Description :
From Genome Similarity Track
Location :
scaffold_11:476524- 478908
Transcript NameFunction/comments
Plaha_PHALS_10737peptidyl-trna hydrolase
Plaha_PHALS_10738hypothetical protein L915_18772

Sequence
2384 bases(100 bases per row)
CAATAATGGAAGACGTGGCCTGGAAGTGTACGACTGCGTTCGTACTTGGCGCTGCGACGCACTATTTCGTCTCCTCTTACTTTCTAAGTAACCGAACGGT
CACAGTTAAAGACTTGACCAATGCAAACAACGACAGCAGCAACGAGGACATCCAGTCTGGTGATTCTTCCAGTTcctcttgtggctcaacagaTGACTGG
GAAGGTAAAGATTCAGCCAGTTGGGTGCCTCACAAAATGGTCATGTGTGTGCGTACGGATCTTAAAATGGGTAAAGGTTAGTACCAGTATAAGTAAATTC
TTGTACCTCTACAATAAGTTAATGTTGATGCTGGTAATTAATATAAGGAAAAATTGCAGCACAGTGTTGCCACGCAACGTTAGGCGCCTACAAACTCGCA
CTCAAACGGACACCAGATGCCGTTCGAGGATGGGAGATGCTAGGTCAGGCCAAAGTATGTCTTAAGGTGGAATCCGAGGAGGAATTGCTCGCTCTAGCCG
ATAAAGCATCTGAGTGTGGCCTTGTTAGCTATGTTGTGGTACGTCAGTAAAGTAACGATAAGTGTTGAGCTGCTGAGAGTCAACGCGATGTATCATTTAT
AAAGGTTGACGCCGGCCGAACTCAAATTGCGCCGGACAGCAAGACGGTTCTAAGCATTGGACCAGCCCCGCTAAAGGTAATCGATGAGGTAACGGGCCAT
CTCAAGTTGATGTAATGAATTTAACATGTGGACTATAATCAAGCTTAAGAAAAAATTGCATGAAGTAAACATACTATGTTAGTGGTGCAAGCTTTGTCTC
TCCAGCATTGATGACATTTTGAACAAATTTGAGCTACTTTAAGAATCCACGGTCTCGTACAGCGAACGGTTTTTGAGGATACCAGCTCGTTGAAGCATGA
ACCCGACAAACACAACATAACTGATCGCAGCAACAATTACGACCACTGTCTCTCCAATCGTTCCCACCACGTCCTTGAACGACAAGGCATAATCTACAGT
GCTAGGGGTATCGTTACGTGAGACGGACATGTAGTCGTGAGGAAGCTTCGATTGAAACGAATCAATGCAAGCTAGATATTCGCCTTTTGTAGTCCACCAC
TTCAGTGTACAAAACGCCTTGACGTGGCACAGTGAGTCCTTGCAAGGTGGAGCGTTCGGCGAACGGGCCCACGTGTTCCAATGGTAATTCTCAATCAAGC
TTACGTTCTGCTCAGCACGGCGCACAAAGGCTGAGAGCTCGGAAAGAGATAGCGATCTGAGACCGTAGGCCTCACTTGCCTTGAACGAAAGTTTCCAGTC
GAGTTGAGTCTCACTCTCCGTGATGTTGGAAGAATACACAGAATAGTCAAGCACGTCATATGTGTCAGGATCGTAGTTCCAAACTATAAAAGACGGATTG
TTACCGAAAATCGGCGAGATTGCACCCGAAATGTACATCGGCATTAGCTGAAAAGTACTGTCCGCTTCTGTAGGTATCTCAAGTGATGGCACAGGTACTC
GGAACTCAATCATGTGAACGTGGCCGAAGAACTGTCCTTTCACTACATGAGCATACTTGCCAACAATGTTTTTGTACTTCACAATATACTTGGGATGCCA
TTGAGGATCGCCTCCGTATGAGTCTACGATTGGCGCAATATGACCAGCAATGTACGCAAATTTACCAGAACTTTGAAGCTTTGCAAGTGTTTTGTCTAGC
CAGGCAAATTGTCCGAACGGATCTGGCTGCTCCGACGAATCTGGCAGATGACTTGGCTATCAAAAAAACATCAGCACTACGTTTTACCTACGTTTGATGA
TCTTACATACTGAATAGGGCACCGTGTTGAGAGTAATCACCTCAAGTTTATCGTCCAGAGCGTAGGTCAAATATCCACGACGATTGAACAAGTCCATGTT
GGCCGCTGACAAGGAGTCCTTCCAAGCATTCGAAATGAGCTCAATAGACGGGTTTGTTTCCATCTCAGGATTCGTCAACTCCATATGGTAGTCGGGATCT
GCCatcattaaatgtataagCTTCTTATTATAGTCAAAAATCATCATTTTCTTCAATCCTACTCGCGTCTGCGTTGCCAATGATGGCCGTGACATCCTGC
AGTCCATTCCAACTTTTTTGCTTGTAATATTTTTCCATTACATGTACATTTGTCTTGACAGCTTCAGAAATGTATGCATCCGTAAAAAGCCCGTGAACCG
CGTGATCTCCAGTATAAAGAAAAAGGTCTGGGTCCGCCACGACGTGCTGCTTCGCGTACTGTAATGCCGACTCGAAGAGTGGCAAGGACGCGTCCTGGAA
GTAGCGGATGGAAAAGGGAAGATTTTCTGTCGTCAATCCATCGGATATATTCAAGTGCACATCCGAAAAGTGCAGGATGCGACC