Description :
From Genome Similarity Track
Location :
Scaffold_16:47649- 48881
Sequence
1232 bases(100 bases per row)
GATGCAGCCGAAAGCATTGTGATACGGGACATGTGCTATGGTCGCTCCATGGTTGCATCCTCCTTCGCACATGCTCTTGGTCAACTTGAGTCTGGGATCT
TGCGGTGTCTTGACGGGGTTGCTGTTCTCCATGCCGAACTTTTCCAGTATGTCTGCTGCAAACTTGGTTTGACGAACGAAAATATTGCCACTGATGAAAT
TTTGATCAATCTCCATGATCAAGAAGAACTGTAGCCAACCGAGGTCTGTCATTTCGAATCGCTCGCATAACGCCTTCTTTGTTGTTTGGAGCATTTCGTT
GTTGTTGCATGCGAGAACCAAATCATCGACATATAGCGCCACAAAAATCATGTCTTCGCCGTCCCACTTGGCGTAGATGCAGTGATCGGTCTTGCACTTC
TTGAACCCCATCTCGAGCATGAATTTGTCAATAGTTTGATTCCACATGCGCGGGGACTGCTTCAAACCGTAGAGAGAGCGCTTGAGCTGACAGACATAGT
CCGGCTTAACTTCGTCGATGTATCCGTCGGGCTGCACCATGTAAATGTCTTCGTCGAGAAGTCCATTGAGAAAATTTGTCTTGACGTCCATTTGGTGCAC
CGTCAGCTTGTATTTGGCCGACAAACTTAGTAGGATCCGAATCGACGTGAACTTGGCCACCGGAGCAAACGTTTCTTCATAGTCCACGCCATACTTTTGC
GAAAAACGCTTGGCCACAAGTCGCGCCTTGAATCGAACGATTTCGCCAGCTTGATTCTCCTTGATCCGAAAGACTCATCGACAACCAATTTCCTTGCGAC
CTTGTGGAAGCGGCACTAATTCCCAAGTCTTGTTCTTGCGCAATGATGCCACTCCGGAGTCGCAGGCATCCTTCCACTTGGCCGCGTTGCTTGATTCCAT
TGCCAACTTGAACGTAGTCAGAATTTCCCCCACTGAAATAACAACGTAGGCAGTTTCAAAATCTTGAGCCGTCGCAATCATCGCATCAAGCGATTGGTGA
AAACTTTGTTCTTGGCCCGGGGAATCTGCAATGCCTGTTCAAGCGATCGATTGCGTTGATGCCGCTTGCTGCCAGGCTCAAAGTCGACGTCAGGTGGGGC
TTGAGGCTGTGAATTCTTGGTGCTGTCCAGCATGGAATTTTGATTGGACGCAGCGTCATCAGTGTCTTGGTCGGACTCATCAGTTTGAGACAAAGTTTCA
TCGACCACCATTTCATCTTGAACGACAACTGT