Description :
From Genome Similarity Track
Location :
scaffold_86:47646- 50567
Transcript NameFunction/comments
g3139.t1hypothetical protein

Sequence
2921 bases(100 bases per row)
CGCCATGCCGGCCTCCAAGAAGCGGATTCAGAACCGCGGCACACTCAATGTGGGCACGCAACAAGTTCCGGCGGCGCTGAGGGACTGGGTGCACATTTGG
CACGGTGTCAAGGTGAATAACGGGTCGGAAGACACTTCTATCTTCCACGCTGGCTCGCGTGTCGAAGAGATGCCGTTCTGGAAGCAGTTTATCCGACTCC
CGTCCAATTCGCTGTTCCCTAGAGTTTTCACCAGCTCCAACCCGAGGAAACCGTACAAGGATTTCCTCTACGTGCTACTGAATATGCGGTGGCCCATGCT
GCTGATGGTTCTGCTAGCTATTTTCATGATTAACATTTTCTTCTTCGCGGCCGTCACGTGTTTCATCTGTGGAGAGCCGACCCATTTCTTCGAGGCCTTT
GACTTGAGTTACCAAACGTTTACCACCATTGGATTCGGTATTGTGTATCCTACGCACACGTGTGGGAACGTGAGCATGTCCGTGGAGTCTTTTGCGTCGA
TGATGGTCGTGTCGGCTGTTACTGGTCTTGTGTTTGCCAAGTTTGCCAAGCCACAGGCGAAAGTGGCGTTTAGCAAGGTTTGCGTCGTGCAGCCCTACGG
CAAAAAGTATCTGGCACTTGTCGTGCGAGTGGCAAATGCTACGCAGTCACGGGACGTGACGCATGATGTGATAATGGAGGCAGTGTTCAAGGTCAATTTG
CTACGTGTCGAGCACAAGACAAGGCATATTCGAGCGCACGACGACCAAGTTACGGAGAAACGGAGGCTTTCTCGAGCAGCGACTTGCATGATGCAAGATG
GCGAAGACGTTGTAGATGCTGCTTGCTCTCCAACTAAAGTGCTGACGTCTTACAACCTCAAGCTGTTGCAGAATAACTTCATTACATTTCGCATGGGCGT
CGCCGTAGTACATCTCATCGATGAAAACAGTCCGCTGTATGGGATGTCCAAGAACGATATTGCCCAGTCCGATATGCTTGTGGAAGTCGCAATGTCTGGC
GTTGACTCAACGTTGCAGGACACGGTTTCGGAGCGGTACATCTATACGGCAGCGAACTTGATGTGGGGATATCGCTTCGCAGAGCTGCTTAAGTTCAACG
AACGAAATGCTGAGGTCATTATGAATTTTGCGAAACTCAGCGCAGTAGTATCCGCCCCAATTGACGATGCGAGGTATCTTAAGCCAATTTTCTCCAGCGA
AAAGCCTCAAGACAGCCTTCAAGGCGATGGACATACGCACAATGTGGCCTACAGGCGCTCACATCGGAAATCTAGAGTATCTCACCACTTAGAAGAAAAC
CATCCTTATCACGATGAGACCATCCATGAAGTGCCATCGGAGTATTCCGAGTCTGTCATGCTGAGTTCGCGGTCGGGATCTTTGGACGGCCAGTCTACGA
TAACGGAAGATGCTGCACCAGCTCACCCCCATCCTCCTGTGTCGTTTTCGAAGAAACCCGGGCCAAAAAAGTTTGCTTTAGGGCTCGAACCACTATTTGA
GCCATTGCTACAGCAGCCCTTTGGAACTCAGCGAATACCGAAAGCTCCATCTGCCGAAAGTAAGGCTGCAATGAGGGGAGGTTTAAGAGTTTGGAGAGAA
AAAGATCATACGAATCTGGAAGAAGGGCGACGCAGGAATAGTGCGAAGCATTTAACTTCAAGTGGTGGCGCAAATACTCGTGTCCGCCATGGTAGCTGGG
ATGCACGTAACAGTGACGGTGGTAGGGGTTCTTTTGAAGGCGCGAATGGCGTTCGAGCGAAGAATATTCTTCAAAGAGAAATGGCGGGGTCTGCATTGAT
AGATGATGATGCCAGTACAATTTCACAAGAAGAAGGCCACAAGGACGAGCTGGACGAGTGTGAAGACATTGACGGTATCGAGTATATTGACGATGACGAT
GGCGAAGATGACGGGGAAGACGATGCAAGTCAGCAGCGTCGACGTGCTCTAACTACGCTGTCCGCTGTGTCAATTGAGGTAGAAGACACGCCTCGCTTCT
TGCGCATTTTACCCGTTCACATCCCTAAGTCGTTCAGCTTTATGCGCCTCTACCAGAGCGCTCTTCACGTCCGCTGGCCTAAAATCATCGTCGTGTTTGT
GCTATCGTTCCTGGTGATCAACTTCGTCTTTGCACTGCTGTACTGGTTCGACGCAGACAACATTTCAACGTACAGCGATGTGGTGGTCACCAAGTATGAG
CTGGCGTTCTACATGAGTGTGCACACGCTGGCGACGATCGGCTACGGCTCCATGGCACCTATGCCTAAAGCAGTCTACATGAATGTTGTTGTGTTCATCG
AGTCGATGGTGGGAATTATTGCGGTGACGATCATCACCGGTATCGCTTGGTCCAAGTTTGCGCGGCCTCGAGCTCACATCCACTTCTCGTCGCAGATGAC
GATCTCAACCATCTACGGCCACCGGTGCCTCGTATTCCGAGCAGCCAATACGAGACACTCGGGCGAGGTGCACGAGAACTTCTTCCGCATCGGCGTGATC
CTCACAAACAGAAGGACAGGGCTCCGTCAGATGTACGATGTGCCTCTGGTGACTGCCGAGTGGCCGTCTATCAAGCTTCCAGCGACGCTGATCCACGTCA
TCAACGAGAACTCGCCGTTCTACAAGTTTCACTCCATGGAGGACCTCTCTCAATCGCGTGTGGCCGTCATCGCGTTGCTCACAGGTCTCGATACGACCTT
TTCGGAGAATGTGTACGCGCGCAAGATGTACTTCTGGGACGACTTTGCATACGACATGCGCTTTGACGACTTCGCTGTCATTGAGCGAGACCGCGTTCTT
GTAGACTACGAGCGCTTCGATCGCCTCATTCCCGAGGACAGAGAGGAGCAGGTAAGCACCACGCCGGTGCTCTCAGTGAGGTCCTCGCTCGCTGACATAG
TGTAACTAGTTAGTAGAGGCT