Description :
From Genome Similarity Track
Location :
Scaffold_871:4764- 6374
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_871-snap-gene-0.6Tripartite motif protein TRIM33 beta
Pytul_var.sporangiiferummaker-pug3_contig_871-snap-gene-0.7Novel protein

Sequence
1610 bases(100 bases per row)
CTGCTGTCATGACGCCCAAAAACAAATCTGCGTCCTCTAAAGATGCACGAGGGTCGAAGAAGCAATCGGCGCAGGAATACGTGGAGGTAGAAGACGAAGA
TGACGGCGACGAAAGCGAAATTGATACGAATTTGGACTACTGCGAAGTGTGTTTGGCTGCTGGGGATCTGGTGTGCTGTGACGTGTGCCCTCGCTCGTTC
CACTTGGCGTGCCTAAAGATGAAAGAAAGCGACTTGCCCGAAGGCGATTGGCAGTGTGCAGAGTGCCGCAAGCCGTCGTACTTCATCAAGTTCCGCGCCA
CGGTCCACATGAAGCAAAGCGTGTACGGCAAATGCGTCGAAACGATTCGGTGCCTCAAGTCACACCCGTACGCCAAGCAGTTTTTATCGCCAGTAACTAA
TGTCGAGCACTACAGGAACATTGTCAAGGAGCCCATGGATTTGTCAACCATTGAGGCAAAGTTGAAATCAGACAAATACGCGAAGTCCGCAGATTCGACG
CAGAAAGAGGAGAACGGTCGTGTGGTGGACATCGACGCCTTTGCGTATGATGTTCGTCTTGTGTGGTCGAACTGCAAGCTATTTAATGATGACGGCTCCG
GCATTACGCGCGCGGCGGATGAACTTGCGGCTGGATTCGAAGGGATCTACAGGGATCTACAGGATTATGTGAAGTCTCAATCTGCAGTGAAAACGGCTGC
TGTGGATACCAGCAGCAGCAACGCAACTGAGACCACTCGCATGAAAAATGCTGCACCTCCGCAAGGTCAGCAAGCGAAGCCATTGACAGCATCAACTTCG
AGTGTGCCCAACGCAGCATCTGCACCAGCATTGCCAGCAAAGGAAAGTGCAACAAAGATTGCAACTCCGTCGCCGCCAATCCAAATAGCACCTGGGAAAG
AACTAGCGGCGAAAGACGTAGCCACCCAGCCGTCTACTGCGCAAGGGAATCCAGCAAGGGGCACGCAGGCATCTGGCCCACCAGCCCCCTCAGCTCAGAA
ACCTTCAGCAGCAACTCGTCCTCACGATGCTGAGCCAGCAAAGAAACCTGAAGCTGTGGCGACGCCTGCAGTTGATGCATCAAACGCTGCGTCGATGAAA
GAAGATGCTGCGCGGCCAGCTGAGTCGAAGGACACGCCGCGAGACGAATCCAGCAAGCTGTGAATGATTTTTCAAAGGAGGTCGCTGGACGTAGGTGATT
ATGTGTATGTTGTGCGTATTTTCTTTTTTCTCGCTGCGTGGAGCCGCTATGTGCGTCCTGCTCGTTTCGAGACTAACGGGTGAGCCGGCGGTGGTTAAGG
TAACCTTCTAAAAAGAGAATCGTTGAAAGAGAACAGAATTGGAAAACTGCGCACGTTTGCGACGTTTCCTTTCATTCAGTCTCGCGAGATTTTCTTACGG
TCTCTAGGCGCTTGAGGTGAATCCTGTGACTTGAAGAGTACCGAGATGGACCTGACTCTGGAGGAAGAAGGCGCGCAAGTGACAACCGCGACCTCGTTCG
ACCCGAATTTCCCACCCAGCAACATTCTCGACGGGTACGCAGCTCTTCGCTTTCTTCTATCTGAGGTGCTTTGCTACCATTTCTATTTTATCCTAATTGG
ACTCGTTCTC