Description :
From Genome Similarity Track
Location :
Scaffold_186:4763- 7060
Sequence
2297 bases(100 bases per row)
GAATTTGAGGACGTCTTCCCCGACGAGGTACCACGTCGACTCCCAGTCGACAAGGGCGTTCAACACGAGATTGACCTCGTGCCCGGCGCAAAGTATTGTG
TCACGTGGTAATGGCCGCTTCCTCGCGACCAAGTCGATGCCATCGACGCATTCTTCGCGGCCCGCAAGGCGGCGGGTCACGTCCGCTAGTTCATTTCACC
TTACAGCAGACGGACCTTCTGTGTGAAGAAGCCCGGTGGGAAATGGCGTATTGTACACGCCTTTAACAAATTGAACGCAGCCACGATTCCGGCTCAGACG
CCGATTCCTCGCAAGGATGTTATTATCGACGGCATGGGTCGATCCACCACTTTCTCCACCATCGACCTTCGCGATGGCTTTTACCAAATCTTCATGCGTC
GATGTGACGTCCCGAAAACGGCGGTTTCTACGCCGAGTGGCATGTTATGGGAGTGGCTGGTCATGCCACAGGGTCTATCCAACGCCCCGGCGACGTTCAA
TCGTATGGCCACCGCGAAGTTTCGGGCGTTTCGCGACTTCGCACCGTCGTACTTCGACGACATTTACGTTCACAGTTGCGCCTCCTCCGCGCAATCTGAT
CTTGACGTTCACCGCGGCCACCTCCGCAAGGTGCTCGAAGTCCTCCGTGCCAACGGACTCTATGCCAACCTCGCCAAATGTATGTTTGGCGTTGACAAAA
TCCCGGTCCTGGGAGATTTAGTGGGGGTGAGCGGATGTCGGGCTGATCCCGAAAAGATCAAGGCCATTTCGGAGTGGCCTATTCCCTCCTCCGTCAAGGA
TCTTCGTCACTGGCTAGGTCTTGTGACGTATCTACACAAATATTCGAAAACAATTGCAGACATCGCTTCAGCCATTGTTTCGGCTTCTCCTCAAGGACTC
CCCTTGGGTCTTGGGACTCCACATGTCAGAAGGCTTTCGACGGCCTCAAATCCAGCCTACAACGCGCCACGATCTTGGCGCTCCCGGACTTTGACAAACC
TTTCTCCGTCGTCTGCGACGCCTCGCAGTTTGCAATTGGCTGCTGCCTGATGCAGCTCGACGCCTCCGGTCGCCCTCGCTCAGTTTCCTACCAAAGCCGC
CAACTTCACGCGGCTGAGCGGGCGTACCCAGTCCACGACTTGGAACTTCTCTCCATGAAGTACGCCCTAACCAAGTTCCGTATCTATCTCCTCGGTGGTT
AACACCGATCATGCGTCCTTACGCACGGTGACAAACACACCACACCTTTCGCAGCGCATGGCGCGCTGGATTTCATTCTTCTCCGAATTCACATTTTCGG
TTCAGTACAAGCCCGGGAAAGACAACATCCTGGCCGACGCACTCTCTCTGCGTCCTGATCTCGAACTGACTACGATCGGTCTCTTAACGTCGGGTCTTCA
TGATCGAATTCGTGCAGCGTACCCCTTTGACGCTGAATGCTCGTCGCGCTTGGCGGCGCTCATCGACCTATTTCCCCCAAACCCCGCCGTGCTTCGTCGG
CCTTACATCACTTCGCCCTCGCCGATGGGCTTTTGATCTTTCAACCCACCCCGGACTCACCGCCGCGCATTGTTGTGCCCGGTGACTCGCAGCTGCGCCT
CACTTCCTTCGATCCTACCATGACTCCCCCAGCGGCGGTTTTTTCGGCCACGACAAAATGCACGCGGTCCTGGCGCGTTCATACTGGTGGCCCCGCATGT
ACAAATCCGTTGTGCGCCACGTCGCTCATTGCGACGCTTGCCAGCGCACTAAGATCACCACCTCCTCTCGGGCCCCGCTCCAACCTCTGTCCATTCCCGA
CGAACTTTGGTCGTCCGTCAGCATGGATTTCATGTTTGGCCTGCCACGCGACGCCCGCGGCAACACCGGCATTATGGTTTGTGTGGACCGAGCGTCGAAG
TACGTTATTGCCGTCCCCGTCCGGGACACGCTGAGCGGCGCGGATGCCGCTCGCCTCTTTTTCGACCACGTTTTCTGTCGTTTCGGCCTGCCTCGCTCCA
TCGTCTCGGACCGCGACCCACGGTTCACGGCGAAGTTTTGGTCCAACATATTCGCCCTATGCGACACCTCGCTCGATATGTCGACTTCGGACCACCCCGA
GTCCGACGGCCAAACGGAACGCGCCAACCGCGTCCTCGAAGATATCCTTCGAAGCTACTCCGTTTCTACCGGTTCCTCGTGGGCTGTCAGGTTACAGCAC
GCGGTTTTCGCTTACAACGCCTCGGTTCAGGCATCCACTGGCTTTTCGCCGCATTATGCGGTCCATCTCCAACACCCCCGCCTCCCTCCAATGCTCG