Description :
From Genome Similarity Track
Location :
Scaffold_12:476276- 479356
Sequence
3080 bases(100 bases per row)
GCGTTTCTCCCAGTAACCACGTGTCTCTCCTCTTTGTAGATCCAGGGTTGAAGAGACTTTGGATCTGGAAAACTCGTCCACTTGGCGCAAACTAGAGACC
CTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGC
AGTACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGTGTCCTAGTTTAACATCTTCTCTGCCACTTCCGGCAACATCCCTCGGTGCTTGGCT
GGATCAAACCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGGCACTTGCCGACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGAT
CCCCGGGATGACCTTTCTTGCCACACTTCTCACAGACCAGATGATTCCAGCATCCAGATTCAGTGTGCTTCCGGGATCCGCACTGTGAACACCTGACCTG
GGCTGTCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCTCGGTCGAGAGTTGTCTCCGGTCTTCGCCGTTCGATCG
TTGGACGCAGTGAGACAGACTCGACGGTAATCTTCAGGGTCGGAGTCCGAACAGTCGGATCCTGACTCAGTTCCTGAGTCAGGCGCCGTGACTTGGTGGA
CACGTCGAGCTGGGGCCGTGGGCGTCGGAGCCTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCG
CAGCACTTCCTCAAGTTCATCTGCGTCTGGAAGACGTAACAGGGTCAGCCTGTCGGCCAGATCCACATCTCCCAACGTCTCGATGAAGTGATCCACGTGT
TCCCGCAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCCAGCGGGGTTTCATCCGATC
TGCGGCGAGCATGGTAGTATTGTCGTGCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAGCTGCGCAGCAAATCCGGCCACTTGTTCCTGGTGGA
TCTGCCCAGCTGCCGATACCAGTTCCAGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCC
GACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTCGATCCTTGCCCGTGAACTCCTTCAGGTCCGATATGGCTGAGATCCGTACCCTCTGGA
TCATGGACGATCCACCTGCCCCGGCTGTGGCTGTTGCTACCACTGCTGACGAAGTGGATGGGCCATCCAGATCATCTGGGTCGAACTCATCATGGAAGTT
GTCTGCCTCCACTGACTCCATTTCCACGTCTCGTGCTCCATGTTCGTGGAGCACTTGCACTTGTGGCACGGGCGCTCTCATACCCTGTTCGGCCAGGAAA
CGACTCATCGCAGCTTCGAAGTGCCGCTGCAGGGTGCCCGAGGAAGTGTCGGAAGAGCCTGCGGCCGTCTGGTCCACTGGCGAGACAGGGTCCGTGAGGC
GATTACCTCGAGCCTGATCTGACGATAATCCCACTGGCTTCTTGCCGGATCTGGCTCGATCCTGGATGAATTGTGTCAGATCACGCGTAGGGCCTACTGG
ATCCCGAGCCTTCACGTTCACAGGGGCTTCCTGTCTTCGGACCCTCGCCCGCGCTTCCAGCATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGTGGC
TCGGACGACGTGTCTGACTCATCCTCAGCGGCGGATTCGTAGTTCGAGGACGCAGCTTGGCTGATCCTCGGCGATGACACTGGATCCATAGTGCGCGACC
TTTCTCCGGTGATGGCCTTAACTCTGGCAAAGAGGTCCTGCGTCGCGGATGCTATGAGATCCAGATCTAGCCCGAAGATATCCTCTGCGTCGAACACACC
AGCTACGATGCCTGACTCTGTAAGCAAACGTAATAGATCCTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCT
TCGATCTGTCGTGGATTCAGGATCTGCATGACAGGGTCTTGATGCAAGAAGTCGCGTAAAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACC
AGCTTGACCTGGATCCAGCTTGGTCTTCTTCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCATCTTCGTCTTCTTTCTCGTTTCTTCGACT
AGCGGGCTTGGGTTTAGGTACGAAGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACATTCCCTTGTTTTGTTAGCGGATCTTGAC
GCAAGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTCTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCCGTCGACAGA
GTTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACCTCCGACGACGCCTCTTCCCCTGGCTCAATCTTC
ACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAG
ATTGCCGGATCCAGCTTACCAACTGCACCCAGACACCGACTAACGGAGAGGGTCCCCCGATGATCCGTGTTCGGCTGAACTTTCCTCACCTTGTGTACCC
GTCGGTAGGGCGGGATCTTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGCGTCTTGGCGAGACGCGGGGATGGGGTGGAGCAGCAG
TGGAAAATCTTCACTCTGCGTCCGTGGATGGTTCCGTATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGGCCGTAGGGTT
GCCTTGCGGGTGTTTTCCCTTGCCTTTGCGTTTCCTTTACGTCGTACTTGCCGCCTCCTGTGACGGGATCTTGAGAGTTG