Description :
From Genome Similarity Track
Location :
contig_7:47622- 49162
Transcript NameFunction/comments
g2463.t1hypothetical protein

Sequence
1540 bases(100 bases per row)
ACGCAAGAAAAGAAGTTATGGCATGGCCTCTCATCGCTAAGCAGGGAGAGAAATGAGGCAGTTGGCAGATCGTTGACGCTTTCCTCGACGGATCATTATT
ATCAAGAGGCGAAAGTTTGATTATGAATCTCCGTCATTAGCATAATTGTTGATTGTTGATGGTGCCATGTACACGTTTGTTGTGATGAACGACGCCAGTA
GGAGATTGCGTGAAATTCGATAGGCGACACGGACTTCAATCGTTTACAATTTGATGAACTCGGAGATGTGCGAGTGCTGCTGTGATTCCTGGCCCTTGGA
CTGGTGCATCATGGGCAGTCGCTGCAGCTTGATGCAGCGCAAATGTGCTTCCAGTTTCGGTTGGAAGAGATTAAGAGCTCCTGTCAGTGTGTCGATGTCA
CTCGGGCCTATCAGTGAGTTTCCACTGAGCAGGAGCTCCTCCAACGTAGCGTTCCCTGTTGCAAATTGGACACCATCGACCATCTCTAGCACGGGTAGAC
CAAGTTGTGCGATGGCTGTGGCTCGATCAATCTTCTTTTTGGCCTTCTTCGCATGGTCCATCTGAACAATTGCAACCCGAATGAGAATGTTTAAATGGTA
CAGGCCAGCGGGGTTTGGTTCCTAGCGTACCTGAGCATGGATTTGACCTCGGCAGCGTCGAGCTCTGCCAAAAGCTCTGGTGGTGCTACGTATTTTGTAA
GTCCATCAACCAACAACTTCGCTCTAAGCAGCAGCACAAATCGTGGTAAGTAAACCAGGATCAAAAGCATGGGTCTCTGGAGGTTTGGCAACTTACCCGC
GCCCGGAGATCTTGTTGTTTGCGAGTGAGAGTGTCTTGAGTGTCGAGTTAAACGGCAAAGCATGTGCGAAGGCCCGCGCTCCAGCATCGCCGATAGAGTT
CTGAAAGAGATTGAGAGCTTCAAGTGTCTTGCTGTGGCGAACTGCTCGAGCCAGCGCTACTGCTCCCCGTGAGGTTATTCCATTCGCACGCAGCGATAGA
AAGAGAGCGCTGATTCCTCGCTTAGTAACTGGGCAAATACTTCCGACGTGTCGTCCTCGCCTCCAGTTTCCAGCTCCTGTTTCATACTGAGTTCATGTCT
TTGATCCTCACTCAACTCTTTTTCTTGGTGTGCTTGATCTTTCACTTGCGGTACTGTTGGGTGTTGTTTGCTGGTAGCACCACCCGAAGGAGGTCTAGAA
GTTGTCGGAGGAGCTGAGGGTGGCCGGGAATCTCCACCAGAAGGTTGAGGAGACTTGACACTTGGAACTGGAGACTCCGAAACACTTGAGGTGCTGGTGG
GGCAGAGTCGAGTGGGTTCCATTCCAGTTGAAGAGCGGTCACGTGCGTCCTCGGAATCGTACAGCATAATAATGCTAGCTGCTCCTTGTTCAACCCGACA
TTAAAGAGGCTAGGCATTGACGCTGGTCAGTGCATACGAAGCACTAAAAGATGCACGTGACGTACCAAACAGAGCGAACTTTGGTGGAGAGCGGGTGCGA
AGCACAATGCGCGGCAGTTCCCGTCATCGAGCTGCCAATG