Description :
From Genome Similarity Track
Location :
Scaffold_12:47616- 50502
Transcript NameFunction/comments
Phymu_g891hypothetical protein
Phymu_g892hypothetical protein

Sequence
2886 bases(100 bases per row)
AATAAATTAATTTTATGAACACACAACTTAGACGTCCACCTGAGCTTCATGGTTGCTGGGATGATACTGCGCATTCGAGAAATCAGGAGACGACACCACC
ACGGGGTATTCTGGAGATCGGAAGCCGAAGGTGCCATGAAGGTGTTGCGGAATTGCTTCCGTGGTTGGAGGAGCCAGCAACGGAGGCCCGAATGGCATCG
ATGGCCCCGGGTTGAAGTAGTATCGCGACGGCGGAAGATCTGGCAGAAACTGTGGCGCATGGAATCTCGAGTACGCGTCACCATTTCCGGGCGAAAAATA
GCGCACCACTTCTTTTGGTGCCGTTTTCCATAGCATCGACTCACTCCAGGGAAGGTTGACACCACCAGATCCTGGCAGTTCGCACTGCCTTGAAAAGTCC
CAGCCAAAGAGCGATGAGGTGGACGCGTATACTTGTTGCAGCTGCCACTCCAactcggcgtcttcttcatgtctACGCTGCTTCCTTCGCCACCGCTGCG
AATCTCCATAGTCGACTACATCTTCTCTATCCAAGAAGTCACCATCGCAGCTTTGGGAATCGAACGCACTGCCAGTCTCGCTCTCGACATCTTCCCACGG
AACACTGACAATGTACTCGTCAAACTTCCGCTTGCCTGCAAATGGGTTTCTTGAGTCCACGCTTTCGATCACATGCTCTTGAGGCTGAAATACTACAGCG
TTGGGGTTTAAACCCGCCGATTTCTTCGAGAAGGGCTCAACTGCTGCCGGCAtagcttcgtcttcttccacatGACTTTGGGCtgttgaagaacttgact
GACAGTCGCTGTCTATAGGCTTGTGCTTAGGCGTTGGTTCAGGTGCCGGCTCATCCATAACCTCGCCACTTGCATCTCCTAgtgcttcagctccatcAGC
ATTATTCACCACCAATTCATCCCTGACTTGGTCTCTGGTAGCACCAGGTGGCAGCGCTAAATGGCCTGCTGCatttcttttctttttcttcttcttactC
CTTTTCTTGTTGGAAGAGACCGATGCGCTGTGTTCCTTTGCTTTATCTTCCAGTgacacttccagcaacaattgctccatttgctgcgctgcttcttttt
CTAAGTGGATGACATAACTTCGTAGGATGAGCTAGATTACACATAACCAGTGTTAGAACGACTGTCAGCTTCGATCTCAAATAGGACAATAGCTCGTACC
TGTTCCACCAGCATCGCGATCAGGCGTTGATAGTTTGCCCACGTGTTAATAGTTTCGCTTTCCGTCACGAAGAGTTTGTTGAAGTTACTCTCCGTGAGCA
CATGAATGGATGTCAAGAACCCGTCTAATACATCTCCTACCAGCGTAAACAACCGATCGGTGTCTTCCGCTAGTTCTGTTTTTACAGTCAAAATACCTGC
AGAGCAACGAAAAGAGAGCGATAAGCTTAAAAAAACACCATCAAGAGCTGCATTCTTGTAGTGAGCGCACCTGTGCCTATATCCATAAATTCCATCGCCT
CAAGTAGCTCGTACGTTCTTTCCGAAGAGGTGTCTGTCGCCGAACGCGTGGACGGCGGTGCCGCCGCACCCTCTTTCCCTGTCGGCGACGTGGTAGATGC
AGCTTTTGGTGCTACCGTCACGGCTGTCGTGGCGACCTCTTTCTTACTATTAAGTGCTGTGTCAGTAGCTGCTCGATTGGAAGTCTTGAGGTGACGCTGC
ATGAGTCCGACACACAACAAACTCAGGTTGAGCTTGTACAGTTGCTTCACAAGCTCTGGTTCGTCCAGAAACAGTATTTGCTGCCGCTCATtgacgctga
gctgctccCAATAGCAACGGACACTTTGTAGCACGGCAACACCATCCTCTCCACCACTGTGACGACTCGTGACCAGGGGCGTAGCCAGCGTCATCCAGat
tccagctcctggtccGTGTATTCCACCTCGACTGGTCAATGATTTTGGTCTTTTACGACCACGCAGATATGTATTGGTGCTAGTGTTGTTCAGTTGATCC
GCTGCGTTGCTGGCATTGGCGCCACATGCGGAAGAACGAATGGCCAGGTACAATTTCCAGATCGGAGCTGTATCAATAACCATCGCACAGAACGCGACAG
TTAGCACGACAATCAATTAGTGCGGTCGATGCACTCATGGTCACGcaccttctgcagctgaCGCGGCCTTCTTCGCGGTGGAGCCGCCCCGAGACAGAGT
CGTCATCTCGACAATTCCTTTGATCCTTTTGCGGCCACCCGAAAAACTCATCGTTCTAGTGTTTTAACACAATTAAAAGGATATAATCTAGTTTTGAATC
AGAAACGGCCATTTTTGCATCCAAACTGAGACCATGGCGGACATCCAGCACAAGCGCGTGGcgctcaagctgaagcaggcgtGCGAGGAGACAGCGGCGC
AGGCCATCGCGGCCACTACCGCCAGTGGCCAGGCGAGCCGTATTCATGGCAAGAACCGCAAGTTCGGCAGCCGGAAAGAGGCGATGGCCGCAAAAGTGAG
TTCAGAGGAGAAAGCGCTGGAAAATAGTCATTGGCTGACGTATTGTTGCagattgcagcagcaaaagcgaaacgagaaggaaaagaagcCGCAGAGAAGT
AAGACGAAACTTTGTGTTAGATTGCTAACGATGCGAATCCTTAGGCGACATCTTGTGTCCGATTTCCACCCATTTCTTTGGTTCGTTATGCAGCTTCTGT
TGGTATTTCAGAAGGAGGGCAGCGAGCTCTAGTAACAAACCACCGGACTGGACGGCCTGCGATACGAAATCCGTTCGCGGCGTGGAGTAGTTCTCTGTTT
TGCATGTTGCTCTTTGTAGCGCTGAAGAGGTTCGACTCAGACTTGATCGGCTATCACGAGAGCAGCTCTGCTTCTGGCTGTGGGTC