Description :
From Genome Similarity Track
Location :
Scaffold_210:47604- 49325
Transcript NameFunction/comments
g10640.t1POM62149.1 hypothetical protein PHPALM_28729 [Phytophthora palmivora var. palmivora

Sequence
1721 bases(100 bases per row)
GATTCGGATGGTGATGTCGAGATGTCGATCCCCCAGCCTATCTTCGAAGTTATCCGTGCACCCGAGCTGTCCAGCTGGGACCACGCTGCGCTGATCGAGT
GCCACCGTGAATGGGAGCGCTACGTGGAGAAGATACGGCATCGATGTACTACAACTGGCAAGACGTATGAGAACGTCGTTGCAACGGTGAAAGGCTCCGT
GAAACGCAAAACGTTGAAGAACCTGGCCATGTACGTCCTGAAGAAACCGGTGGACGATGTGACTGACGCAGACATCATGAGCGCTGTCCAGGCACGTTGC
CGCACGCTCAAGAACGAGTTCGTGCCTGATGTCACATCCTTGTTCCGTCAATCCTTGAGGATGGACCTCTCGGTTGATGACTGTGATGCCCGAGTGATTC
GCTACTACGAGGACTTCAACGGAATTGTCGAGGACAATGGTATGCAAGGGCTAATCGGAGCAGGCAGCGAGTCTGACACGGGCTACAGGAGCAGAATGAA
GGCTCGCTGCCGCCTATTGGTCGAAAATCTGTAGCCTCCTGTGTTGAAGGCCCAAATCAGTCGACTGATAGAGTTAGAGAGGCGCGACTGTAAGTCCGAT
GACGTCGCCCTCTTTGATTTAATATTGGAGCATGCGAAAGTCCAACAGAGATTTCACCGGATGTCGCAAGACACGACAGCCAAACGAGACGTCAAAACAA
GCAAGCAAGTGCGGCCGCCCCAGCGCAGCTCCGATGGTAGTTCCATGGACGGAGCTTCCCGTGTTTCAGCTCCTGCGCCGACAGCACCTCGTGGCGCTGT
AGCTCCCACCCCTCTCTGTGTGGCTACACCCCGACCCCCTCGGCCGCCACCACAAGACGGCTGCCTGGTGTTTAAAGGCGCCCATTGGCTCAAGGACTGC
CCCCCAGCGACGAACACACAGAAGGAAGCCGCGCGTCAGCAGTATCAGGCCGTTAAGGAACAGCGTGCAGGATCTGTTCGCTCAAAGGCGGTACGCGCTG
GAGCAACGAGAAACATGGTGCGAGTGAACGGACTTCTTGAGGTCGCGTACATTGCGGACACTGGCGCTGACCAGAGCGTGATCCCCAGTGCGATGGCAGA
CTCGCTGCGTGCCGTGCAACCTGGTCTTGGGATAGTGCCTCTTGATTCCCCCATCAGTGTGACACTAGCTGATGGGAGCGTGCAAGTTTGCGAAATGGAG
ATAGTATTGGACCTCGAGCTCGTGACCATCGCAGGCGCTGTCAACCTACGCGCCGTGCCATGCCTTGTATTGGAGGGTGAGGGCGACGAGGTTTTGCTTG
GCAAGGACGCTTTGAAACGTTTGGGCATCGTTGTTGACCAGACCCTGGCCCAATTGGCTGATTCGACGTTGTTGGAAGACGAGGAGGAGGAATATCCAGT
GGGTGACGAGCTGCCTGGCGATGCATCGATCCCCATTACAACATTGGATGAATTGCTGGATCGAACGGTTGCTAACGGTCTACCCCATGAGCACACTACA
GCAGTGCGTGATATGCTGGATCTGTTTCCCGAGATTTGGCGCGATGCTGTAAGTTCTGGTGCGGCGGCGTCTGTTGAGCCACTGTATGTCAGGCTACGTG
AAGATGCGAGGCCGTATCGAAGCCCTCCCCGCAAGGACACACCACTACAGGCTGAGTTTATTCGCGAGTATGTCAAGTCTCTGGCGGCGGAAGGTTTGGT
GACCAAGAATAACGCGGCGCG