Description :
From Genome Similarity Track
Location :
Scaffold_1091:476- 2768
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1091-snap-gene-0.5Protein pelota
Pytul_var.sporangiiferummaker-pug3_contig_1091-snap-gene-0.9Trafficking protein particle complex subunit 2

Sequence
2292 bases(100 bases per row)
ATGAAGCTCCTGAAGAAGCAGATCAACGAGAAGGACGGCATGGGCTCCGTGGTGCTGCGTGCTGAGGAGCCCGAGGACATGTGGCACGTCTACAACCTCA
TCCACGTGCACGATTCGGTCAAGACCACCACCATCCGCAAGGTACAGCGCTACCAACCCCCCAACTGCGCGAGGTGGCAGAACTCAGCTCACTGCTTGTG
TTTGGTATCGTGCATGCGCTGTTTAGGTCGTGAAAGAAGGCGCGACGGGGTCGACTAGCAGCCAGCGCGTGCGCATGACGCTCCAGATTGAGGTGCGCGA
TGCTTTTTGAATGAGACTATTGCGAATGCTGGGTGTCATTTTGACTCATGAGTGCGTTTGTAGGTGGAGCAGATCAACTTTGATCCGGCGCTCTGTGTGC
TGCGCATCAAGGGTAAGAACATCATGGAAAGCCAGCACGTTCGGGTATGATAGAGCGCTTATTGAATGGATAGTATAGAATGGGATGGGGTTGTGCTCAT
TGTTGGCTTGTGCGCGTCTATCTAGCTCGGCGCGTACCACACGTTGGATCTGGAGATGAACCGCGACTTTACGCTATTCAAGAACTGCTGGGACGTCATG
TCGCTCGAGCGCATTGAGACGGCGTGCGACATCGCCAAGAAAGCTGAGCTCGCGGCCGTGGTCATGCAGACGGGGCTGGCGCATCTATGCCTGATCAAGG
GCCACATGACGGTGATCAAGGCGAAAGTGGAAAACAGCATCCCAAAAAAGCGCACGGGCAGCACGGCGCACGCCAAGGGCACGGAAAAGTTCTACNNNNN
NNNNNNNNNNNNNNNNNNNNNNNGAACATCGTGCGCTCGATCAAACAGCACATCGACTTCAAGCTCGTCAAGTGCGTGCTGCTCGCGAGCCCCGGGTTCG
TCAAGGATGACTTTTTCAAGTTCATGATGGAGCAAGCGATCCGACAGGACGACAAGCTGATTATGGAGAACAAGAACAAGTTCATCCTCTGCCACTCGTC
GTCCGGCCACAAGCACGCACTCGATGAAGTGCTCAACGACCCAGTACGTTCTCTTGTATCCACTGTTTCTTGCTGTGGCCCTGTGAGGCTGGAGCTCATT
CTTTGTTTTCATGTGTTGCAGGCAATCCAATCCCAGGTCGCGGACACGAAAGCCGTCGAAGACGTCAAGTGCCTCGAGACGTTTTTCAACATGCTGCACA
CGGACCAGGACCGCGCGTACTACAGTTACAAGCACGTGATGGCCGCGAATGCGAACATGGCGATCGAGACGCTCATGGTCACGGACGAACTGTTCCGAAG
CCAGGACATCGCGACACGCCGAAAGTACGTGGACCTCGTCGAGAGCGTGCGCGACAATGGCGGCACCGTGCGGTTGTTCAGCAGTCTGCACGTCTCGGGC
GAGAAACTGGGCCAGATCAGTGGTGTGGCAGCGATTCTGCGGTTCCCGATGCCTGAGATCGACGAGGCAGACAACGGCTCTGATAGCGACGTGTCAGACG
CCGAGAACGACGACTTGAACGACGAGAGCGGCGTTGGAGACCTGTCCATGGAGTCGCTCTCCATGTAAATAGATCGGCACACGTCAAACTCGACAATAAC
GACAAGGGAACAATGGAATACGAAGTCATAGTACACGTTGCGTTACGCATTCGCCGTATTGTGCTGCAGCACGAGGTTGTACACTTTCTTTTCAAAGTTC
TGGGACGTGATCCGCTCGCCGATCGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTCGACATCGCGTTCACATACATTTTGTG
CATCTCCGCAAAGAACTAGAGCCAGGGCATACGCACATAAGACAGTAACATTCGACAACAACAAGAATAAGAACGAGGTCGCACTATTCCATACACCACA
CGAGATGGACTCACCGATCGGAGCTCCGACTCGCGCACGGGAGAGTCCTGCATGATTGCCACGAACTTGATCGACGTGTTGGTCACATAGCCGTACACCC
GGTAGTCCTCGATGGGGCCGAGGAAGCCCAGGTACATGTCATCCTTGGCCGCCATGATGCCCGCGCTACGCAGCTTCTCCTCGATGATGTCGAGCGACAC
GTGCGCAATGTAGTGGAAGCCCAGGTCCTCTTCTTCGTCAAACGTGCGCACATACAGCGGACTGTTCTGCACGTTTAGAAGTATATACACATACAAAACG
ACACTTTCAGTACATCTATATATACGCACATGCGTGCATTGCGCTCAAACGCACGCACCGCGGCGCCGATGACCGCCACACACGAGATCATG