Description :
From Genome Similarity Track
Location :
Scaffold_390:476- 1478
Transcript NameFunction/comments
Sapdi_VS20SDRG_17448hypothetical protein

Sequence
528 bases(100 bases per row)
CTGGTCTTGCGCACTGCCCCACACCCCAAGGTTCTTGATGTCGTTGCCGTAGTAGTCGAGGTCGCTCTTGGCGTTGGCGCACTGGCCGCCGCTGTTGGGC
TGCGGCGCGGGCCCCGGGTTCTGGCCGTTGCCTTGCAGCGGAACGCAGTTTTCTACGCACAGTATCGCAGCGTGAGCCATGGAGCCATAAAGGTCGTGGG
ACGCACTGTAGACTTGCCACTCAGGCTGGTGTAGCGCAATCCAGTAAAAGCGCAGCATGCAGCCGTCGCCCGCGCAGCTCGAGTAGTCGACGGGGAGGTG
CGCGGCCGGCTTGTCGCCAAAGTTGGTCGCGCAGTCGTCGTTCTGAAACACGCGCTTGTTGTCGAGCCACACCTCGCAGGGGCCCTACCAATGAGTGCAG
CTTGAGTATACATAGAGTAGTGTCGTTGGGTACCGTGTGGCTCGGGATGAAGCCTTCGCCCGTGTCGGGGTTCTGCCACGTCATCTTGCCGTCCGATGGG
ATCGCCTTCTTGGCGACGTTGGTGAGCG