Description :
From Genome Similarity Track
Location :
scaffold_8:475958- 477105
Sequence
1147 bases(100 bases per row)
TCATGTGATTTACGCCAAGTAGATGCCGACAGGCATAATGTTATCACGCGATCAAACGATAAGAAGATTTTTGCGCTGAATAATCTCTCAACATATTCAG
GGCGCACCTGTCTGGCTCTAAGCCGACTGTGatatatacagatcatgtttCGTCGCACACGGCAACGTCACCACATCACTCACAGAGAATGGCAAGATGA
TCATATACTTTACCAAGTATATTTCGGCGTAAGATATAAATTTGATGTGGTGGCGGGTGAGCAATTGCGTTGTACCAATTATGTTTGTAACACGTTACGA
TTGTTCAACCACTAATGATTGAGGCGATACGTGCAGCGTACGGACCAGGCAAAACGTATGTTGTGTTGTCAAATTTGGAAAGCAAGGTGTCTGAGAATTT
ACATGCTTTTATGTCGAATCGCACGGTTGCACGTCTGAACGACTTTGCCTTATTTCAACGCTTGTTTTACTTCGGCAATGACCCGCAAAATACTACACGT
GTGGTAAGATCTCATGCTGAGGGCTTCGAGCGGAGAATACCGCACGGGGTATGAGATGATACTACTTTGGATGTCACATCGGTAGGGGAGTACATACTGC
TCGGTGAGCGCGATGCATTGTGGTCCGATATGTACGCAAAGGTTAGCACATAGTGGCTTATATCAATGGAGTAAACACTAGTCGCACGAGCCGGTATTTT
AGCCAATCTACTGATTCCAGCAGAGTGTTTGCAGTCCATAATTATAGACTTTATTTTCGGTCTCCCACAAAGGGCGTCCAGCAATAGTGGCATTGTAgtc
tttgtggactggcTGAGCAACATAGATCATCTCGCTACTGTCAGTGACATTCTAATCGGTGAGGATACACCCAAGCTGTTCCACGACACAGTGTTTTGCC
AATTACCGATAGCCATTATATTAGTTGGAGCCTCACTTTTCATGTAAGTTATGACGAACATTGttcaaggtgcttggcaccaGATTGAACATGTCAGCCG
CTTATCATTAATAAAAATAGACGATTAGCTGGAACGCGTTAATCACGTGGCAGAAGAAGTCATCAAAATCACTGGCGTGGAGAGACGGTGGTGCTGGAGC
GACTTAGTCCCGCTCAATGATTTTGCGTATGGCATATCTCGACAGGA