Description :
From Genome Similarity Track
Location :
Scaffold_6:475867- 480548
Transcript NameFunction/comments
Hyaar_Emoy2801318xylose isomerase domain-containing protein

Sequence
4681 bases(100 bases per row)
CCGCGTGCGTTCACGCTTTTTATCAACCAGTCAGGGTAAGAATGAGTTAACGGACTATGTCCAAGAGCTGAGAACTCTCATGGCTGCTATGCAGTCTGAC
CCTCAGCCTGAGGCAGTCCATGTGACTATATTCATAGAGGGTCTCCGTACTGGTATTGCCAGAACCGAAGTCTTTCGGGTTCACCCCTCTACATTCGAAG
AGGCTGTGAGAATTTCTCTTAATGATGAGCATAACTTCAGGTCGGCCGGACTTGGCTGGAATGGGTACAACCCTAGCTCTGCGAGAGCGAACTCCACGAG
TACTTCAATAGGCCGGAACCGATGGATCTCAGCTATGCTGAAGATGAAGGTGAAGTTGAACTTCAAGCTGATGAGCAGCAACGTGTTGTACGACGGTGTT
ATACGTGCGGAAGCACTAAACACTTTCGGCCTGGTTTCCCTTTGCGTAGACAGCGTCAGGCGACGAGTCAACACTCTACCCCGAGCCAAAATTCTGGCAT
GGCACGGGGAAATGCCGACACCCAGTAGGCGCGGGGCGCCCTACTGGGGAAGAACTAGGTTATGTAACACCTTTAGGAGGTAAAGGTGAAGAGGACTTAG
CCCCAAAGAGTTCCATACCTACTGGTATGGAGCTTGGATACAAGTCTGGATTGTTAGTCGCTGAGGCGAAAGTTAAAGGCTCTGAAAAGCCTTGGTCGAT
TTTAATCGATTATGGGGCGTCTTGCAATGATGCTCGACGTCGTTCCCTTGAGGGAATTCAGCGTTATGTTGAAGCGCTTACAGTGCATGAGGGTGATTCA
ATCACGGTTCGTTTAGCGACTGGAAGTCGTGTCACTGTACCTAAAGTTCCGTTGAACTTAGGTATAGAGTTTTTGGGCTTTAATAGCATTGAACGCTGTC
TTGTCATTGATTTGGAATCGAGATATGATCTCATCCTAGGTATGGCTTGGCTTGAACGCCATAAGCCATGGATTGATTGGAGGTCTAAGACCTTAGGCGC
TACGCGCGATGTTCCTAGCGAAGTTTTGGCGAGTCATGAACCCACCTTTGCTAGGCAACAAAAGCACTATTGGCGCGAGCTTTTGACAGAAGATGTCAAT
GTTCTGGACATTGGGATGTCTGAGTTAACTAACTCCAATGTTGAAAATCTGAATTCCGAGCGTAGCTCGTTGAGTATTAGTGATACGGCACGTACTCCGT
TGAGTGTTACTCGTTGTGATGACGAGTCACGGCATGCTGAAAGCATGGTTGGCCTAGGGCCGAGTTATCAAGGATATGATTCCTTTGATGTGTGTGTGGT
GGCACGTGAAAATACACCGAGTGCGGTCAGCCGTGAAGGCACCACACTTAATGTCGATAATGACATTGTTGGCGAAACGCCAATAAGTTCAGGGCTAGGC
CCGTATAATGTAAGTGGAGTGGCACTTTTAAATCCACTGGGTGAAGTGTTCGAGTTACGTAACACTTTACCGGATGTCGATCAAGACATCAGCTCTCGTA
AAGAGCGTACTACTACTACTAGTAACCACGAGGACACTATTGTCCCGACCCCAGAGGGGTGTAAGGTCTCATCGAAGAGACGACCTGGACGCCAGGTGGC
AACTGTTAAGCGCCAGGCGTCCGAGCGGTCACATAGTGACAATAGTAATGCACTATATACAATTGTCAACGGAGTGACTGGCCAGGTTGAGGGCAATGTT
AGCCTGGAAACCCTTCCATCTTTGGATTCTCTTTGTGAGCTAGACGAAATATCTGATGGCGAGTTTAGCCAGGCCTTGAAGGCAGGAGATTTATCCGAAT
TAGTGGTCATTAGACCCGATGTCGAGTTGAACTCGTCCTCATTAATTGATGAGTCGGTCCTAGAGGACACCAAGGCGGCACTCAGTGCCCGGAGTGGATC
TTCGATCCTTAAAGATCCTTTGGATCCATTCTATCCTTTGGTAAAGAAATTTCAAGATGTGGTGTGTCACAACCCACCATCTATCTTACCTCGCGATAGA
GATGTACGTCACGAAGTTGACCTGGTTCCAGGAACTAAATACTGCGTAACACGGCAGTGGCCTTTACCTAAGGAACAGTGTGACGTCATTGACGATTTCT
TTCGTGCTAAGCACGCAGCGGGAATGGTGCGGGAGAGTAAGTTTCTCCATTCCACACTTACTTTTTGTGTCAAAAAGCCTAATGGTAAGTGGCGTATTGT
GCACGCTTATAATAAGCTCAATGCTGCCACTATCCCGGCTCAGACACCAATCCCCAGAAAGGATGTTCTTCAGAACAATATGGTGGGATGTACATTGTAC
AGTGCGCTCGACTTAGTCGATGTTTATTACCAGCTGTTCATGCGAGCAAGAGATATTCCACTAACAGCGGTTAGTACCCCCCTAGCGGTATGCTCGGGGA
GTGGCTCGTTATGCCACAAGGGCTGTCAAATTCCCCGGCTACTTTTAATCGTCTGGTGAAGCAACTATTCAGACCTCATCGAGGCTATACACAAACGTAC
TTTGATGACATCTTTGTCCATAATCGTGCAACGAACGGTCAAACTGATGTGGATAATAACATTGATTATTTACGAGCGGTGCTCGAGTGCATGCGCACGA
ATAAATTGTATGCAAATTCATCTAAGTGCATCTTTGGTGCAGAAGAGATTCCTTTTCTGGGGTGCTTCATTGGGAAGCGAGGCCTTCGAGCGGACCCCGC
TAAGGTAAGGGCCATAGTCGATTAGCCGGTTCCAAAGAACCAAAAAGATCTACGTAAGTGGCTTGGCCTTGCCAATTACTTGCATACGTATCGTGAGAAT
CACGCAGATATGGCTCGGCCATTATCCAATCTCCTTAAGAAGGATGTGGATTGGTGTTGGGGTAACACCGAACATGATGCTTTTCAAGCAGTTAAGGAAA
GTCTCCTTCATGCGCCAATACTGGCTTTGCCCGATCCTGATCGGCCTTTCAGTGTCGTCTGTGACGAATCTGACTTTGCCATGGGCAGTGCTCTGTTACA
AACAGATGTCGATGGACGCGAACGCGTCATTGCATTCGAATCTCGACAGCTCAAAGCTGCTGAAAAGAACTATCCAGTTCATGAAAAAGAGCTACTTGCT
ATGAAGTACGCTCTAGTCAAATTCAGAGTACATCTGCTTGGCTCAAAGCCATTTGTGATCTATACAGATCATGCATCATTTCGCACTGCGACACAGTCGC
CGCATCTCTCTCAGAGAATGGCTCGATGGCTTTCATTATTTGCCGAATATAGCTTCAAAGTGAAGTATAAGCCAGGAAAGCAAAATGTTTTGGCTGATGC
TCTATCGCGCCGACCTGACTATGAGCTTGCTCACGTCACTACGCTGTCATCGTCATTCACTGACTTAATCCGTGCGGCTTATGCCAAGGATGAACAATGT
GTAGCTTTGATACGTGCTCTTGGGAGCGAGGAGTTTAAAGACTCGGACATAGAATTGTCGGCACGTTTACGTGCGAGGCTACATCGATATTCTATCGATA
ATGGCCTGTTGTGTTATCGCACAGATATTGAGGATAACCCTCGTATCGCTGTCCCTCATGATGAGGAGTTGAAGTATCGAATCCTCTATGAGGCACATGA
TACCGCTTTAAGTGGTCATCTCGGTCGTGAGAAGACCTATAGATCAGTGAGCCAGGCTTATTGGTGGCCCAAACTATACAAGTGGGTGAGCAACTACGTG
CGTACGTGTGAAACGTGTCAACGGGTTAAACCCTCAGCACATGCGGCGGCGCCACTGGATAGTCTGCCTGTACCCACTGGGTGTTGGAAGTCCATGAGTA
TGGACTTTATGTTTAGCTACCGAAAGATTCGGAAGGCAACACTGGCATTGTGGTCTTTGTTGACCGATTGAGCAAGTTGGCTCATCTAGCGGCAGTGCCG
GACTCTATTGATGCCGAAGGTACAGCGAAGCTGTTTATCGACCGTGTGTTTCGACAACATGGTTTTCCAGTGGCAATTGTCTCGATAGAGATCCCCGCTT
CACTGGGAAGTTTTGGAAGTGCATCTTCAAGGTGCTCGGCACCCGTTTGGACATGTCCACAGCGGATCATCCACAGACCTATGGTCAAACTGAGCGTGTT
AACCGCTTCATTAATGACATTTTGCGCAGTGTTTGCGCTGATACGCCTAAGCGTTGGAGCTCCATGCTCCCTGTTGTTGAGTTTGCGTTGAACAACGCTG
TTCATGCCTCTACAGGCTATACTCCGTTCTACGTAAAACGGTCTCACCCACGCTCGTGTTCCGTTAATGCTACCGCTATGTGGTTCAGGGCTTGGTGAGG
GAGAGGTTGCCGATCAGCTTGCTGATATCAGCCCTTCTACTGCTCGAAAACAGGTAGGGAGTTTCTCGCAACGCGATTGAATGTCTTAAGAGATGTGCGT
GACGCAATGGCTGAAAGCCAAGACCAACAAAAACAACAATCAGATGCTAAAAACAGAGGTTGTATTGAACGTTATCAGGTCGGAGACCAAGTATTCCTCA
ATGCAAAAAACCTACCTACAAATGTAGTGTCCGCTGTCTTCAAGACAAAGTTGCGTCCACGCTTCATTGGACCATTTACGGTCACTGCCAAGAAGGGACT
TGCGTATACGCTCAACCTTCCACGCAAATTGCGCACACATCCTGTTTTCTACGTTGGATTGCTTAAACTGTATCAAGATCC