Description :
From Genome Similarity Track
Location :
Scaffold_144:47583- 48617
Transcript NameFunction/comments
Phymu_g5424HECT E3 ubiquitin ligase, putative

Sequence
1034 bases(100 bases per row)
TTGTACTCAATTTCCAGTTTGAAGCTCCAAGTACGAAGATGCATAACGCCTGCCTcgaacggagctgctccaagTTCATTCCGTTTCCCATCGCTGCAAG
CAAAATTGCTGTTGTGGAGATATTGTCAGCGAAAGGCGATCGGAGTTTCATCAAGTTAGAACGTACTCAATCGTTACGTTGATGCATTGCTCTAGCACTC
GAGGGAACAAGTCGATATAAGACGCTGAAGGCTCAGCTAGCATGCGTTGCCCCATTGGCTCCAATAGATGCTGCACAAGTCTGTCGATAAATTCTCTCTG
CATATGGACAAAGTGAGTTCGATAAGCTGAAACATCCCAAATCATTAAGAAACGCACAGCAGAAATTCGAGATCGGCCGCCATCTTTGCTCGCTGTGGGG
GTGCACATGTGCTTGGCAATCTAACACACAAAAATTGTCAGTGAAGCCGATTGTATCTcatactacagtagtaaGTGTGAACCGGGGGCTCTACCATTTC
AACGACCTCAACGATGGCCTCCGTCAGACTGGCAAGGTGCACTTTGCCTTGAGCATCGATAGAGGCCAACTCCATTGAAATATGATAAACTTGCGGGACA
GCGCACGGTTTTGATCGCGAAAGTCGTGGGGTGCGTGCAATGCCACTGTCCAGTGGATATCGAGGCGTTGAAGCCACCGAGGAACACGCTGATGATTCGG
AAGATGCCAGGGACGCAGTAGTAGTTTTCGGTGCCTTGGAGTGATACGTTACCGGCTTCGGATGGGTATCGTCTTGATCGGCGCTTTCGTTGCTTTCGAT
CAGTCTCAAGATGTGCGCAGTCTGGCGTGAAAACCGCGTGAGCACTTCATGTTGAGCTAGCATCGCCCACAGCACAGTATCCGTCTCACCCCTGTAGATC
GCTCCATCCGGAGTCATGCTCTGATGTCGAAGAGAAGCAAACCTAGCACTCGGAATTGATCGCGTCGCTTTCGTCCACGTCAAATACTTCCGGAGCGTCG
GCAACAGCATCGACAGAAGCATCACAAATGGGCA